Transcript

dym-202

ID
ZDB-TSCRIPT-091110-1669
Name
dym-202
Previous Names
  • dym-001
  • ch211-167h3.1-001
  • dkey-263o8.2-001
  • si:ch211-167h3.1-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000043332 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000043332|OTTDARG00000031161|ZDB-GENE-091204-348 dym|OTTDARP00000034351 CH211-167H3.1-001 LG_ CT033824.16 Danio rerio protein_coding NOVEL, 1851 bp
GGCTCATTCTTCTGCGCGTGCTCGGCGAGGTGGGATGTCA
CGAGCGTCATTGGCGACGTGGAGACGTATACAGCACAGCA
ACTTACACTGTTAAACACACTTTACTGGATATTTAACATC
ACTACATACAACTCATTTACTCGTACTAGTCCGAAGATAC
AAAGGAGCCTGTGTTACGGAACGAGAGGGGCTTTTCTAAG
GCGCTGTCAGCTCTGAAATTTAACAGGTTTGTGTGCGTGG
AGATGAGGCGTTAAGACCGTCTCTGGGGGATTCTGGGGCT
GATGATGGGTGCAAACACCAGTCAGGTGAGCGACCTGTCG
GAAAGCCAGAGCATCCGCACTCTGATTGGACCAGACGCCA
TTTCAGAGAACGAGCCCTTTTGGAACCAGCTGATCTCATT
CACCTTCACAAGCCCCACCTGCAGTGCTGATGCTAAACTC
CTGGAGGAGGCTGTCGTCCCGCTGGCCAAGACTCTGATTG
AGAATAACCCCAGGTCCGGGAACTTCGGGGCGTTGGTGAG
AGTTTTTCTCAGCAGAACCAAAGAGCTGAAGATTTCCACA
GAATGCCAAGATCAGTTGTTCATCTGGCAGGCCCATAATG
CTCTGTTCCTGGTGCGCTGTTTGCTGAAGGTCTTCATCAG
GGAGATGAGTGAAGAAGAGCTGCATCTACAGTTCTCCTAC
CAGGAGAGGGCGCCGGGAACATATGACTCCATCAGCGAGG
ATCTTCTGGAGGAGCTAGTCTGTAATTTGGTGCATCTCAT
CGTAGAAGTACCGCTTCTTGACATCACCTACAACATCCTG
TTTGAAGCTGTGACCACACTCCTGGTGCTGCTGTCCTATC
AGCTCTTCCACAAGGAGATCCTCAGAGAAGGCCTTATTTA
CAGATACCTGACCAGAGGACGATGTCTGTCTCTGACGAGT
CGTCTGGTGAAGACATTGCTCTATAACTTCATCAGACAGG
AGAAATGTCCTCCTGCTACACACGTCTTACAGACGCAGTC
AGAAGGAGGAGGCTTACTGTATGGATTTGCATCAGGAGTC
GCCAGTGGTTTATGGAGCGTGTTCACATTGGGCGGAGCCG
GCAGCAGGCCGGGGGCGGAGCAAGAGCAGAACCCTCTCCC
GCTGTCCAGTCAGAGCCTGCTATTACTGCTGGTTCTTGCC
AATCAGACGGATGGCCCCGACTGCCCCAACCCTTATCGCC
AGGCTGTGACCTGCTTCAAAAACACTCAAGATTCTTCATC
CATGCCGTCTCCTCAGCCTCACACGTTTCAGATCAACTTC
AACAGTTTGTACACGGCTCTGTGCGAGCAGCAGAAATCAG
ACCAGGTGACGTTACTCCTCTACACGCTTCTGCACCAAAA
CAGCAACATGAGGACGTACATACTGTCCCGCACGGACATG
GAGAACCTGGTGTTGCCGATTCTTGAGATCTTGTATCACG
TTGAGGAGAGAAACTCTCATCATGTGTACATGGCCCTCAT
CATCCTCCTCATCCTCACAGAGGATGACACCTTCAACCGC
TCCATACATGAAGTGCTGTTGAAGAACATCTCGTGGTACA
CCGAACGTGTCCTAACAGAGATCTCCCTAGGAAGTCTGCT
AATCCTGGTCGTCATCCGAACCATCCAATTCAACATGACC
CGCACAAGGGATAAATACCTCCACACCAACTGCCTGGCTG
CGCTTGCCAACATGTCGGCACAGTTTCGAAACCTCCACCA
GTACGCCGCCCAACGAATCATAAGTTTGTTTGCTCTGCTG
TCAAAGAAGCACAATAAGGTTTTGGAGCAGGCGACGCAGT
CTTTACGAGGGCCTCTTGGAGACGAGGACAGGACCGTCCT
GCCAGACTATG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations