ZFIN ID: ZDB-TSCRIPT-091110-163
Transcript Name: slc7a1-202
Previous Names: slc7a1-001, ch211-69k21.2-001, ch73-60g14.1-001, ottdart00000043161, si:ch211-69k21.2-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000043161 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000043161|OTTDARG00000031046|ZDB-GENE-091116-69 slc7a1|OTTDARP00000034223 slc7a1-001 LG_ AL929315.8 Danio rerio protein_coding KNOWN, 2223 bp
CGCAGAAACATCGCAGCTCAGCTGGAGAAACCAAGCTGAA
GAAAAGTTTTCCTGCAACACGGCGAGTATCCCTCTGAGCC
CCGCGATAAGATAAACAACACAACTGAACACTGTGAATCA
TCAGCATTCGCAGACGGACCAGATTCATTTAAGGAGACAT
TTCAAATTAATAAAACGAAGCAACCAACGAAGCTGTCTTC
ATACCGGATCAGCAATGGTTTTGAAAAAGCTTCTGCGTTT
CGGGAAACAGCTGCTGAGAGTAAAGGTTGTAAACTGCAAC
TCAGAGGAATCGCGACTGTCCCGATGTCTGAACACTTTTG
ACCTGGTGGCTCTTGGTGTGGGCAGTACATTAGGAGCAGG
GGTTTATGTCCTGGCCGGAGCTGTGGCTCGAGAAAACGCC
GGACCGGCCATTGTGCTGTCGTTTCTCATCGCCGCTCTGG
CTTCAGTGCTCGCTGGTCTCTGTTATGCAGAGTTTGGAGC
CAGAGTGCCCAAAACAGGATCAGCGTACCTGTACAGCTAC
GTGACTGTAGGAGAGCTGTGGGCCTTTATAACTGGCTGGA
ACCTGATTCTTTCATATGTTATAGGTACCTCAAGTGTTGC
CCGAGCTTGGAGTGCCACATTTGATGAGTTGATTGGAAAA
CATATTGAGCATTTCTGCCGCCAGTACATGTCCATGAATG
CGCCGGGCGTCCTGGCGGAGTATCCAGATATGTTTTCTGT
TTTCATCATCCTCACACTCACAGGCCTGCTGGCCTTTGGG
GTGAAGGAATCAGCCATGGTCAATAAAGTGTTCACCTGCA
TCAACATTCTGGTGCTGCTGTTCATGGTCGTCTCTGGACT
AGTCAAAGGGACTCTGAAGAACTGGCACCTGGACCCCGAT
GAGATCCTCAATGCAACCAACTCCACCCTTAACAGTGCCA
CGCAGCCGCTGCCATCAGAAGAGATGCTGGGTCAAGGTGG
CTTCATGCCTTTCGGCTTCACAGGGGTTTTATCAGGAGCG
GCGACCTGCTTTTACGCCTTCGTTGGCTTCGACTGCATCG
CAACTACAGGTGAGGAGGTAAAAAACCCTCAACGAGCCAT
TCCCATCGGCATCGTCTCCTCGCTCCTCATCTGCTTTGTG
GCGTATTTTGGTGTATCAGCCGCGCTCACCATGATGATGC
CCTATTACATGCTGGATAAAAACAGTCCTCTTCCTGTGGC
GTTTAAGTATGTTGGTTGGGAAGGAGCTACATATGCTGTG
GCTGTAGGGTCTCTCTGCGCCCTGTCCACCAGCCTGCTTG
GCGCCATGTTCCCCATGCCCCGTGTCCTGTGGGCCATGGC
TGACGATGGCCTGCTCTTCAAATTCATGGCTGGGATCAGC
GAGAGAACAAAAACACCCATAAAAGCCACTATAATGTCTG
GCTTTCTCGCAGCAATCATGGCTTTCCTGTTTGACCTGAA
GGACTTGGTTGATCTAATGTCTATAGGGACTCTTCTGGCC
TACACACTGGTTGCTGCCTGCGTTCTTGTACTCAGGTACC
AGCCGGAGCAGTTTTCTCAAACATATCACATAGCCAACAC
ACATGAAGACATGGAAATGAGTGAAACAATAAGCACACCC
AGCATGGGGATCCTGCCCGGCGTAGAGGAGCGTTTCAGCT
TCAAAAACCTGCTCTTTCCGGACATCATCGAACCCTCCAA
CCTGTCTGGATTCACCGTTAACATCTGCACCAGTCTGCTC
GGTCTGCTGATTCTCAGCTTCAGTCTGTTGGCGGTTCGGG
GAGGAATAGCGAGCTGGAATATCATCACTCTCGCTGTCCT
GTTCGGCCTGTGTGTCATTGTCACATTTATCATCTGGAGG
CAACCTGAGAGTAAAACCAAGCTCTCTTTTAAGGTTCCTT
GTCTTCCCTTCATTCCGGTGGTGAGCATGTTTGTCAACGT
CTACCTGATGATGCAACTGGACAGAGGCACCTGGATACGA
TTTGCCATCTGGATGTCTATAGGACTCGTAATCTACTTTG
GCTATGGGATCTGGCACAGCACCGAAGCCGCTCTGGCTCA
TTCCAGTATGGACGAAGAGTTGAGTGTGTACAAACCTGCC
TGCGGTCTCAACCGAGACAGCGTGACCCCAGAGAAAGAGG
CTTTCCTCTGTAATGGCCACGGGTCACAGGTAGATGACGA
TGGAGATATCTAAATGAGCAACAGTGTTATGTTGTATACT
CAGACTTTACAGAAAGCACTCCG

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
slc7a1-202 Contained in:
[BAC] CH211-69K21 (1)

Genome Resources: Vega_Trans:OTTDART00000043161 (1),  Ensembl_Trans:ENSDART00000146370 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:BC055209 (1) 2209 nt
GenBank:CT652714 (1) 815 nt
GenBank:BQ783939 (1) 689 nt
GenBank:EB898643 (1) 602 nt
GenBank:CR930551 (1) 539 nt
CITATIONS (2)