ZFIN ID: ZDB-TSCRIPT-091110-1619
Transcript Name: mtus2a-202
Previous Names: mtus2a-001, ch211-69k21.4-001, dkey-76a19.5-002, si:ch211-69k21.4-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000043158 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000043158|OTTDARG00000031043|ZDB-GENE-091204-75 mtus2|OTTDARP00000034220 CH211-69K21.4-001 LG_none AL929315.8,CR933781.4,AL928852.7 Danio rerio protein_coding NOVEL, 4956 bp
GTGAGCACGAGAAAGATGCTTGGTTCAAAACACCGCGTCG
GAGCGCTGCGTTCAGTCAGCGGGTCTGCTGTAGAGGAGAA
CGGGCGCTGAGGGCTGTAGGAGGGCACACTCTACCTGTCT
TTCTCGAAGGTTTGGCACCAGGTGGATGAACAAGACATTT
CAAGGTCATAAAGTGATGTCATCAAATGCATTGCCCTGTT
GAGGATCGAATACATCTCAGTCTGTTTTCAGTATCTTGGA
GCAGAAATGAAAACGAGTGAAATGTGGTTGTGAATGTGTG
TCTTTGAAGGACTAGGTGGAGGCAAGTGAAGGAGCAAGAC
CTTTGATGGATCCAGGATTACTGCTGAGCTTTTGACAGAC
TGATACAACATGAATGTGCAAGGAAATGCACAAGCTGGAG
AAAACAACCAACGGGAAATACAAAACGAGGACAAGCAGAC
TTTGCTAGAAGCTGTAGAAGATGCCAATGCCAATCAAATC
ACCAAAGAAAAAATTAATTCAGATGACCGAGAGAATGACA
GTTCCGTACCCATGTCGCACTCTGAAGCAAAGGAGAGGAT
CATTATCTGGGGAACACATGCTCGAAGTGTAGACCCTGAG
CTGGAAGAGTTTGAACTGCTGGAGTCTAATGAGTTAGAAA
CATTTATTGTGGACAAAGAAGAGGTACACATTTCGAGTGA
GAGAAGACAGAATGGAACAAAAAACTTTGGTGACAGGAAG
TTGACTTTTGGATCCCCTTGGAAAGACCACAATGAAAACC
ACAGTGTGGATGGAGATGCAAATGAGAACTCACAGCCCCT
TGACCTCAGGACCTCTAGCTCTCGCTCTGGTGCAAACCGA
ACCCTGAGAGATGGCCGAAGTGGATCTGAAAGCAATGTCT
TTTCATCTTCTCTTTCTGCAGTGACCAGCCTCAGTGGAAG
TTTAGCCAGTGCCCTGGACACTGCAGGCTGCACACAGCCT
CTCTATTCCCAGTTCACCAAGTCTACCTCAGGCAAAGGCA
GGAACCAGCAACCAGCTACTACTGAGTCCTTCATCCACTC
AGAGAGAAACAGGGATCTTCCCAGGGATTTGGACCAAAAC
CATAACTCTACTATACTGCCTCAGGAACCACAATATGACC
GAAGTAAGCTAATCACTCCAAGTGGTGCATATCCTTCAAA
TGGAACCATAAAAGTGCATAAATTCCCAATGGAAGCGGAG
CAGAATACTGGATATAAATGGATGTCAACTGAGGTGCCGA
AAGGTATGGTGAGGGTACAACCTTCTTGTCGGCAGCTTGT
CCGCCCTCTTTCTACAGAAAAGCGATTAACCTCAGGATAT
CCCAACAGTGACCAGGCAGACCAACAACAATCCCACTATT
CAGAGACCTGTCATGGACATCAACAAGTGCTAGCTTGTAC
AGAAGTCAACAGTAATCCCAACACAGGCACAGAGATGGTT
CACAACCAGACCTTTACCAGAGAAGCCCAACGTATAAAGA
GGCAGAGCTCAGCAGATCGTGCCGCAAGTCCCTCCAGCCT
TGAAAGAAAGACACACTTCAGCCGCCGGGCCTACAGCAGT
CCAAGTAGACCATCCCCTCCTCCATCCCCCAAGACCACAA
GGTCTCCTCAAAGGCATCCTTCATCATCACCCATCAAAAC
TTTACCCTCTCGAGCTCCACAGTTGGGTTATGCTGGGTAC
ACTTCAGGCTTAAGAGCCCCAGTGAAAACAACTATTAACA
CAAGCGTTCACAAACCTCTTGCACAGCAGACTTCAATGGA
GACCTCCCCGCCAAGCAAGTGTCTGCCAAAACCAAAAAGT
GTCCGGCCCAAAATCATCACATACATTCGAAAAACCCCGC
AGGTGAAACCCCAGCCCCTTGAAGGATCTTACGAGGTGTC
ATCCTTACCTACAAGGCTCTCAACATACAGCAGCACACAG
GCCAAACCAGCTGTAGGAGATCAAGGGGAAGCAAGTGTGC
TGAGTGCCTCAAATTTACTCTACGATAAGTATCGACAAGA
GATGCAGAAGGTCCGATTATTCTCTCCTGGACTAATGGGG
TCTGGGATTAAACCACCCAGCAACACCATGCCTCACAAAA
TGGCTGGCAGATCGGACAGCTTCTACGGGTCTCTTAACAA
GCCTCTATCTGCAGCAGTGGGACGATCCGCAGTTGGCCTT
GGGTCTCCAGTGTCTGCAGCTGAGGACCCATCTGGATCAC
CTATGGGAGCACAGGATACAGGGAGTCTTTTTCGTTCACC
ACGGGGCCTAAGACCTCAACTTGGCGTTGGTGCTGTAAAC
AGGACTCCTTCTGTACTTGCAAAAGGCAGGATGACCTTAA
CAAGTCACCCAAAGTCACCACTGACCATCAGTCAACCAAT
GCAGGCAGTTAACCCAACCACTCAAACTCCTCAGGAAACA
CAAGATCAGAGAAAGCCGGTGTCGACGGGTTTAGCTGCTA
AATCTCTCCTGCCGAAGCCGGCTCAGGCTCAGTCTGGCCT
GCGTCCTCCTGGTTATTCGCGTCTCCCTCCGGCACGACTG
GCTGCTTTTGGGTTCGTCCGAAGCTCCAGCGTCTCTTCTG
TGTCTAGTAACCACTCCACTGACAGCACACGGAGTGACCC
CTGCCGACCTGCTTACCGTCCCAACAGTGTAAATGATGAG
CCACCGCTTCACCGTGTCACCACATCACCACCTGGGGATG
GATCCAGAGCACCCTGTCGCAGCACCCCTCAACCTCCAAA
CACTCCTGCGCCCGTACGCCGCTCCCTGCTACCTCCTCCT
CGAAGTTCACCCGTGTTATCCCGTAAGGAATTCCAGAAGA
GTTCGGATGGCTCCCGTTCATCCCAGTCATCCCCTAAGAG
ACTCGCTGTAGTGTCTCCTAAACCACAATCTCCAGTCCTT
CAGAGGCAACAGAGGACAACAGTGGCGGTCCGAGGATCAA
GCGTGCAGATACTGCCTCGCTCTGGCTCCCCAGGACTGGA
AAAGAAAAAGGCAGAAGAAGAGCAGAAGAAAGAGAAGGAG
CGCGAAGAAGCAGAGAGACACGTGGAGCTGCAGATCCTGC
AGGGTCGCTATGAGGATCAGGCCAGAAAACTGCAAGCCCT
TCAGACTGAGCTGAAGAGAACCAACATGGGCCTGGAGGTC
TTCATCATCTGCACTCAGCACTTCTCAATCAAGAGTGAAA
GTGCTGAGCAGAAGGAAAGAGAGCTGTCAGAGGAACTTAG
TCGGATTCAGCATGAAGTGGCCTTTAACGCAGCCCGCTGG
GAGCATCTTCAGAAGGAGAAGCGAGAGCTGGAGGAGTGCT
TCGAGAAGGAGCTCAGAGAGTTACAGGTGCAGCAGAATTC
TGAACTGGCCACCTTAGAGGAGAAGCTGAGGTTACGACAC
GCTTCAGACAGAGATCATCTGAGAGCAGAGCATCAGTCAG
AAGTGGAGGAGCTCCACACACAGCACCAGGAGCAGATTGA
AGAGTTGACTGCCAACCATGAGGCTGCCCTTGAAGACCTG
AAAACCATGCACAACATCACTATGGCAACACTCCAGGAGG
AACATGCCAGGACGATGAGAGATTTAAGGAAAGCCCATGA
GCAGCAGAAAGCCAGTCTAGAAGAGGACTTCGAGAAACTG
CGCCTCTCACTTCAGGATCAGGTGGACACTCTGACATTCC
AGAACCGGACTCTGAAAGACAAAGCTAAGCGTTTTGAGGA
GGCACTGAGGAAGAGCACTGATGAACAAATTGTGGATGCG
CTGGCCCCATATCAGCATATTGAGGAGGATCTGAAGAGTC
TGAAAGAAGTTCTGGAGATGAAGAACCAGCAGATTCATGA
CCAGGAGAAAAAGATCTGTCATCTGGAGAAAGTGGCTCAA
AAGAACCTGTTCCTGGAGGAGCGGGTCCAGGTACTTCAGC
AGCAGAATGAAGACCTGATGGCCCGCATAGACCGACACCT
AGTTGCGTCAAGACAACTGTCTGAAGAGAATGCAAACCTC
CAGGAGAATGTAGAGAAGGAAACCAACGAGAAAAAGAGGC
TGAGTCGCAACAATGATGAGCTGCTGTGGCTCCTCCAGAC
AAGTCCCCACCTATCACCAGCCTCATCCCCCATCCACAGA
GCCTTCTTCACCGGCCCTGATATTCCCCCATACTCTTACT
CTCCAGGCCCTGGGACCCCCACACACTCGTCCTCTCCTGG
CCCTGGTACACCTACTCACAAGGTGGCATCTCCGGCACCA
GGGACACCCACTTTCAGAGGCTCACCAGCACGCTCGTCCC
CCGCACGCATCCCAAATGCCAATACTTTACCTAGATGAGC
TGGATAATGCAATACTAGCTGTATTCCATCTAGTTTCTGC
CCACAGCAGTGCTTCACTTTAATCTGCAGCCCCTGATTGT
CATTTTTTAATATTTATTAAGATTTTGACAACCCCTACTG
CCATAAAGCCTGTCATTTCCGTTATTCAACTTTGAGATAT
CTTTTTATCTCATAGATTTAGACTTGTAGCATTAGATTAA
AAAAGATAATGATGCTAATGCTATTATTGATGTGCTGCCC
ACACTGGGCCAGCATGGAGGCAGAAACAATTTTGTGTAAA
CGGAAGTAGCTCAGCTTAAACTTGACTTTAACATTCTTTA
AAGGTCTGTAGGTCCTCCTGAATGGCATACAGGAACTTTA
TACAACAAACAGCACTTTAGGTTTCTGCCTTTCCTTCCTA
CAGATAAATGCACCAGCATTTTTTGTGGTCTGGTTTATTT
TTTTATGAAATATGTTTTCAGGTTTTACAATTCTCCCAAT
GTTTCAATTTTTAAATTTGTCAAAACTGCAAAATGTCATT
TTGGTAATTATTTAGTATCCTTGAAAAACCTAAACATTCT
TTTAAAAGAAACTGACTTAAAGATTTATTAATCCCAACAA
TTTATGTTTCAAATTCTATCTATTTTCATTCCGCTATGGC
GACCCCCTGATAAATAAGTGGCTAAGCTGAAGGAAA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
mtus2a-202 Contained in:

Genome Resources: Vega_Trans:OTTDART00000043158 (1),  Ensembl_Trans:ENSDART00000141387 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:AL924024 (1) 386 nt
CITATIONS (2)