Transcript

ltn1-201

ID
ZDB-TSCRIPT-091110-159
Name
ltn1-201
Previous Names
  • dkey-175g6.5-001
  • rnasekb-001
  • si:dkey-175g6.5-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000043142 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000043142|OTTDARG00000031028|ZDB-GENE-091204-127 si:dkey-175g6.5|OTTDARP00000034211 DKEY-175G6.5-001 LG_ CR926463.9 Danio rerio protein_coding NOVEL, 5898 bp
CGACTACTGTGACTGTACTGAAGTCGGAAAAGAAGTGGAC
GTTTAGCCGACACAAGAATGGGGGGCAAAAATAAACAGAG
AACGAAAGGAAATGTTCGGCCTTCCAGCAGTGGCAGAGCT
GCTGATCTGTTGGCCCGGGAGAGCGGTGTTGTTCCCGGGT
TTGTGGGATTCGGTGTCTCGACCTCTAATGATTTAGGATA
TGTACCTGCAGTACAGGGGGCAGAGGAGATAGACAATCTA
GTGGATGCAGACTTCCGCATGGTTCTGCGGAAATTGTCCA
AAAGAGATTCAGTCACAAAATTAAAGGCAGTACAAGAGTT
TGGAGCAATGTGTCAAGAGCGGCAGACTGATGTTGTAAAA
GGTGTCCTGCCATACTGGCCTCGGATATACTGCCGGATAT
CGATGGACCACGATCGCCGTGTGCGAGAGGCCACACAACA
GGCCTTTGAGCAGCTGGTTTTAAAAGTCAAGAGGAATCTG
GCCCCCTACCTGAAGAGCATCATGGGTCACTGGCTCATCT
CTCAGTGCGACACGTACTCTCCTGCTGCCTCAGCCGCCAG
CGCTGCTTTTCAGGCTGCTTTTCCCCTCAATAAACAAACA
GAGGCTATCAGCTTCTGTAAAGATGAAATCCTCAATGTTC
TCCAAGACAATTTGCTGAAAGAAACAGCGGACACACTTAG
TGACCCTAAAAGTGTGCCAGGAGAGGAGCGAGAAGCTAAG
TATATTCGGCTATTGACTAGTTCTCTGCTGGCCCTGAAGA
GACTGCTATGTGCTTTACCTGAGAAAGACAGAGAACAGAT
AAAGGATGGACTTTCCCAGCTGATCACACAGGCTAAATTC
TGGAAGTACAGCAAACACAAGACCCCACAGATTCGAGGGG
CGTTCTTTGAGCTGATTGCCACCATGTGTGAGCGCACACC
TCAGCTGATCCAGGCAGAAGCGGCTCGAGCATGTTCTGCT
GTTCTGCTTTCTATTGATGACACAGATCCAATGGTGCTGC
CACCTCTGTGGGAGGCCGTCCTCCATATCATGTCCTGCGT
TGATAACTGTTGGATGCATGTAAGTGCTAAGAAAGGCGTG
TTGCCGAAGCTCTGGGTGCTTCTTAAAGAAGGGGCTCGAG
GCCTTGCAACATCTCTACATCCAAACCTACTCCCGTTCAT
AAGCAAACTGCCAGCAGAGGTCAAACAGCCGGACCTGGAG
TTCTCCAGGACATTTCTTACATCCATCATTGAGGGATTGT
CGAGCGATCGTGCCTCATCCAGTCCTTCAGAAAGTGCAGC
CATTATTGATTCCACAATGGAGTGTCTTCGCTTTATCATC
TTGCAGAACGCCGGAGATGAGCAGGAACAGAGAAACATCC
AGAACATGCTAATCTCAGAGCAGCTCCTTCCTCTGATTGA
CAGAGCTCTGAAAAGCCCAGCGCTGCAGTCGGGCCCTCTG
TTCCCTCAGCTCTCAGATATGCTGCTGTCCTGGGAAAAGC
GGGCGGCAGGAAAAGATTCTTCCACTTTTCAAAGACTGCT
GTCAGATTTCTGGGAAGGTCTGAGTCGCTTGTGCACAGCT
TACGTGGACTGTGAGGAGTCTGAACGAACCGCTCTTGAAG
GTATTGCGTTGCTTCTGCAGATTATGCAGAATCCAAACAG
TGTCGGTAAACAGACCAAGAAGAAGAAAACTGTCAAAATT
AGCTTCGCAGACCATGAAGAAAGAGGCCAGGGGGATGAAC
CTCCGAGGCAAGCTCCAGTGGTGGAGGAGCAGGACTGTCC
CTTGAGACATGAACACCTGCTGGATTTGGTTTGCCAGCTG
GCGGAGCTCAACATGGTGTACGTGAGCGAGCGGGAGTCAG
AAAGGCACCTGAGGTTTTTGTCTCAGCTGCTCGGGGCGTT
TCCCAGGCCTGAGGTGTTCCAGGTGCTGCTGCGGCCAGAG
GAAATGAAGCCTGAAATGGGGTCAGAGCTTCGGCCACTCA
CTGAGAACGCAGCTGTCCACTTTCTCCTGCAGAGAGTGGC
TGTGTGGTTAAAACAGGAGGACAGGAAGGACACAGATTTC
CTGGTGGACATGGTTTTCAGTTCCCTGCAGTGCTGCAGCT
CTGATTCTGACAAGACACTCATCCTCAACCAAATCAGCAA
GGATCTGAATTGGAGTGTGACCCTTCAGCTAATTGAAAAG
GCGTGTTCAGACCCTGTCCGTCTGGAAGTGTGTGTGGGCT
GGCTAAGGGGTTCAGTGTTGGGAGAGAGGCTGGTGGGCCT
TGCTGGAGATCTGTGTGAGATGGGTTTGTGTGGGTCTCCT
TCATCTTCCTCCTATCATGCACACGGCTGGCCTCTCATCA
GCCTCGCTCTGTCACAGCAGCACAATAATGACCCTCTTAT
TGGCAAGGTGTATGTCGAGCAGATCATCGACAAGCTTCAT
GCCACCCTGTCAGAAGCAAAGGGCATGTCAGATGCTGGAA
ACCTGGAACCACTGGTCACTTTCATCTCTGATGTTGCTGC
CACTTTCTTTTCATCGGTGAAGAGCTGTCTCCTGCTGACG
TCTGCTGAGGAGCTGCTCATGACTGTTTTCCAGCTCTGTG
CACAGGACCAAACTGTCACTCATCTCTCAGATGCTCTTCT
GCTGAAGCTCCGGCACGCATACATTGCTGGCATTGAGTCA
CTGATCGGTTTCCTGGGCGCAGGAGTCACGAAGGGCACTC
TCCTCCATAATATTGCTCTCTGGGTTAAAAGTCAACTGCT
CAATACACCAATGACAGTCAAAAGTCTGCAGGTTTTGGTA
CAGGCTGTTGAGAGTCTGGCTCAAACCATTGCCTCGGCAC
AGAAGACCAGCTGTCTTTTTTCTCAGTTTATATGCTGTCT
TACTCCTACTGAAGAGGAATGGAGACACATTAGACAAGCA
CTGCCACCTCAGTGGTTGAGAAACCCTCTACTGTGTGGTC
GTCTCAGAGTCACTGGCCAAAACCCCTCCATGGATGTGTG
GAGGTGCAGGGCATCAAACCGGCTGCCTGCACACCTGTGT
GTAAGTGCTTTACTGGGTAGAGTTATCTTCACTGCAGCTT
CACCTGATGACCAGCAGGTGGAGGCAGACCTCTCCGAAAT
ACCTGATCTCAAACACATAGTTTCAGAGATTTTTTATGGC
CTGCAGTGGTGTGAAGAAATGGAGTTTTCACCCCTCACAG
TGTCTGAATATCATAAATTGCTCCAGTCCTGGAGTTTGGA
ACAGAAAATTCACAATATCAGCCTGATCAAATCCGCTCTT
ACAGACACACTTTTTACAAGATCACAAGAAAATGGATCTC
TCTGGTCACTGTGTCTGGCGAAATACTTGCAAATCAATAA
AATGGACCCAGGTGACATCAAAGGCTTATATGGAAGTGTT
GAAAGTTTCTTTCCCCTCTCAGAGCACAGTGTGAATACTC
TGCAGGTGCTCTGTCCGTTTCTAGCCAGCGAAGACAGAGA
ATCCCTCATCGCCTTGTGTGTCGCAGAGCTACTCAACTGG
CAGGACCAAGAGCACGACTGCAGTGTGCTGTGCTGTCTGG
CGGTGTTGCTGTGCTGTCTGCAGGCTGATGCTGCTGTGGA
GGATGAGATTCTGCTGGCTGTCGTCAGCACGATCGCTGAA
TGGAGGAACAGTAGAGAGGAGTGGTTCCTCTTCAACAGTG
ACCTTGAAAAGGCTTCCGCTGCAAGGCTGTTGCTGGCTGT
AGAGATGATGCGTTTCCTGTGCTGGCTGGTGGATCGCTCT
CCTGCAGTGTTGGGAAACACTTATTGGGATCTCCTGCTCT
GCTCCATGCTGGCCTGGCTGGAGACTGCCAGTGAAAACAG
CGCTGTGTTCTGGAATCCTTGGGTGCAGCTGTTTGTATGC
ACAAACTGTGAGCTGATTGTTAGGCTGAGTGAGTTTTTCA
CATCGCCCCCTGCTGGTGTGTTGGAGCAGCTTCCAGCAGA
ACTGAGCTCCGAGTGGAAGGAGTTCTTTCAGGAGGGGATT
CACAACCTTCTGCTCCCGCTGCTTATTAAGATCCCCATGG
ACTTTCCAGATCCAGATGACCCTATGTTCCCCCTACCAGT
GTTGAGGGCGGTGGGGGAGGCTCTCACCTACATCCCTGTG
GAGCTGCTCACTCAGAATAAACTCCCTCCTCGCTTTGTAG
CCGACCAGAAGAGTAGCCTGTCTGAGCCCCTGCAGACCCT
TCTGAACAGCCTCTCACCCCTGCTGCTCTTCAGAGCCCGA
CCACTGCAGCTCGCCGTCTACCACATCCTGAACAAGGTGA
TGCCTTTGTTGCCAGAGAGCGACAGTGAAAGTGCCAGCGC
TAAATCTGAGGATGAGGATGGAGAAGAACCGTGCTTGTCT
CCTCCGGCAGCATTGATGAGCATCCTTTCCACCACAGAAG
AGCTGCTGGAGAATATTCTAGGTGCTGTACAAGTGGGCGA
GTTTGCAGTAGTGCAGCCGCTCAGCATGGAGCACTGCTGC
ATTCTGGGATACCTTCTGTCCTGGAAACTCCTCCTCGCCT
TTTTCAAGGCTTCTTCTTCTCATCTGCGAGCTCAGTACTC
TCTGCATTTAAAGAAGAGCCGTTCTCTTCATAAACTCCTG
CTCCATCTGTTTCGTCTGATGCCAGAGAGTCCGTCAATGC
CGGGACAGTCAGCAGCGCCCAAAACCTTCTTCACCGAGAG
TTTGTCTCTCTCTCCTGGAAAAACTGAAAATCTACAGTTT
GAGGTTTCTCATCTGGCCTGCTCTGTCTACTACGGTGCGT
TAAAAGACCTGCCCGCAATGGTGCGTCTGTGGTGGAACAG
CCAAGAGAAACGCATCTTCAGCATAGTGGATAAATTCACC
AGCAAGTACGTCAGCGGCATTTTGTCTGCACAGGAGATCA
GCTCAGTGCAGTCCAGCACCGTGACCTTTGAGAACATGAC
GGTGAAAGCGCGTTCAGCCACGCGGGAGGTGATAGCGACG
TACTCTGTGGAGGATGTTTTCATTGAGCTGGTGATTCAGC
TGCCGCAGAACTATCCTCTGGGCTCCATCTTAGTGGACAG
TGGGCGGAGAGTGGGCGTGGCTGTGCAGCAGTGGCGCAAT
TGGATGCTGCAGCTTAGCACATACCTTACTCACCAGAATG
GTAGTATACTGGAGGGTCTGTCGCTGTGGAAGAACAATGT
TGACAAGCGTTTTGAGGGGGTGGAGGACTGTATGATCTGC
TTCTCTGTCATTCATGGATCCAATTACTCGCTGCCAAAGA
AAGCTTGCCGTACCTGCAAAAAGAAGTTCCACTCCGCCTG
TCTATATAAATGGTTCACGTCTAGCAACAAATCCACGTGT
CCTCTTTGCCGAGAGACTTTCTTCTAAACTCTGTCTCCAT
GGACACCGATAATAGGTGAATGACGTCCTCGGCGAACAGC
TGACTCGGAGAGAAACGCTCGGTTGGTTTGTTTGTACATA
TTGGTTTTGCTGCGCTGCAAATTACTGTGGCCTTTTAGTT
TTGAACTGAAGTGTTCAACAACTCCGCAAACAATGAAACA
AATAAACAGTCTGATTTTCAGAAAACATTGCACCCAACTG
GAGAAAAGGAATCTTGGCAAGAGACTGAAGAGTGAATAAG
CATTTGCATTAATGGCCTTAAAAGAAGAGTTCATTGTAAT
ATGGACGTTTTGTCATTATTTACTCATCCTTGTGTCATTC
CAAACAGTTTCATGCTATTTTTATCAGGTAAAGCAACAGA
ATTTTGAAGGATCCTGACATTTCTCCACAACAGCATCTGT
CAAGCTTCCAAAAACAAACAAACATAAAAGTAGATTGTAT
AAATTTTATGTGATTTGTCATGGCTTGTTATTTTCTCAAG
ACATTTTTTAAAACACAAATTACACTTGGAAAGCTGGGAT
TGATAAATTAATCACATCACAAAATGTTCATTTTTGAGTG
TTTAAATTATATTTAAAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations