Transcript

lrrc32-201

ID
ZDB-TSCRIPT-091110-1569
Name
lrrc32-201
Previous Names
  • lrrc32-001
  • ch73-211p17.2-001
  • ch73-46j18.3-003
  • si:ch73-211p17.2-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000042960 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000042960|OTTDARG00000030912|ZDB-GENE-090630-1 lrrc32|OTTDARP00000034092 CH73-211P17.2-001 LG_ CU469093.5 Danio rerio protein_coding NOVEL, 1980 bp
ATGGGGACGTGTCTCTGGATACTGATGCTCATGGTGTCGC
AGGTCTCACCGTACAGACGTCCAGCTGAGGATTCACCCTG
TCGAGTGCATCAGGACGATGTGGACTGCAGCAGTCTGAGT
CTGAGACGGGTCCCGGCGCCGCTGCCCTCTAGTATCCGCC
TGCTGGATCTGTCCCAAAACCTCCTGCAGAACCTGACCCT
TCAGGATCTGCCGTCCCGCTCCAGCCTCCGCCGTCTGGAC
CTGCATCACAACCAGATCCAGTTCCTGCAGCCGGGGCTCT
TCCGGGACCTGCTGCATCTGGAGGATCTGGACCTGTCGGG
GAACGCGCTGGACCTGTACGCCGCTCTGCACACCCCCCTC
GGCCCGCTGCCGGCCCTGCGTCGCCTGGACCTCTCCGGTA
ACGGGCTCTTCACTGATATGAGTGATTATTTCCTGAGCGA
CGCCCCGGCCCTCACTAACCTCTCCTTAGATGGAAACAGC
ATCACCAAAATCAGCAGAACCACATTCAACGGCTCGCAGG
CGCTCCAGAACATTGACCTACACAACAACGTGATTATAGA
GATCGAGGAGGGAGCGTTTGAGTTCCTGACGGAGCTCTCT
GAGCTGGATCTGTCCGTCAACTCCATTTCCTGCATCACAG
ACTTCAACCTGGTTCAGCTCCGAACGCTGAACCTAAGCAG
AAACAGCCTGACGAACTTCCAGAGCTTGGACATGGAGGAC
GAGTTCCAGCTTCAGCATCTGGACCTCAGGGAGAACAAGC
TGCTCTACTTCCCTGTCCTGCCCCAGAGGAACAGACTGAT
GTACCTGGATCTGTCCAGAAACCTGCTGCGCAGCGTCAAC
TGCTCGGGTCCGCTGGAGGAGCTGGAGAGCCTGCGGGAGA
GCGGGTATCTGCTGACGGCTCACGATAAACCGCTGACTCT
GTGTGCCAATGAGCGGCAGCAGGAGCTCGGCAGGCTGCTG
TACCTGGACCTGAGCTTCAACCAGCTGAAGACGCTCTCGT
CCTCCTTCTTCAGCAGCATGGCTGCTCTGGAGAGCCTGAA
CATCAGCAATAACTGCCTGCAGAGCTTCAGCGTGGACTCT
CTGCGCTCCCTGAAGACTCTGGACCTCAGCTTTAATAACC
TGCAGAACCTGTCCTTCAGCGGAGGCGCTCTGCCGGCGCT
GGAGGTGCTGCTCCTGCAGGGAAACGCTCTCCATCTGTTG
GACGCTCATATATTCTCCAGCCTCCCCAGCATCCGCAGCC
TCCACCTCCAGCAGAATCTCCTCAGCATCTGTGCCGACCC
GCAGATCTCCAGTGGATGCGTGCATCTCTCTGATATCCCA
TCCCTCACCTACCTGTACCTTTCAGAGAACTCATTATCCT
CCATCCCTGATGGAGCATTTAAAGGATCTCCCCTGCTCAT
CCTGGATTTATCCCTGAACCCCGGCGTCGACATCACCGCT
GCGTCTCTGTCAGGTGTGGAGACGTCTCTAACTCATCTCT
CTCTGAGAGGAAACCAGCTGCATTCGCTCAGCATTGACTT
CAGGGTCTTCCAGAAGCTGAGATCTCTGGATGTGTCGGTG
AACCGTCTGTCAGGTGTGTCTCCGTGGAGCGAGGACTCAT
CAGTGGAGATCCTGAATCTGCAGAATAACCGTGTGGAGGC
GCTGGGCTCCGCGCTGCTGCAGGGGCGGCTCAGGACGCTG
TATGTGGGCTGGAACCCGCTGAGCTGCTGCAGGAACCCGC
AGCTCCTGGATCTGCTGCAGCAGGAGCGTCTGCACGTGCC
GGACCTCGCCGCCGCCACCTGCTGGTACAGTGGAGACGTG
GAGCAGGTGGAGGTCAGTGTGAGCGCGGCGCTGCCCGAGC
TCTGCTCGTCTGCGGACTCCAGAGTGCTGTGGGTCAGCCT
GATGGTGGCGCTGGCGCTGGGGCTGGCGCTGGTGCTGACC
GTCAGCCTGAAGCTCTGCCACAGCAGAAAACACAGGTTCA
AGAGAGGCTTCAAAGCTTGA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations