ZFIN ID: ZDB-TSCRIPT-091110-1556
Transcript Name: fam163b-201
Previous Names: dkey-180g13.1-001, fam163b-001, ch73-340n8.1-007, si:dkey-180g13.1-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000042919 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000042919|OTTDARG00000030888|ZDB-GENE-091204-96 fam163b|OTTDARP00000034068 DKEY-180G13.1-001 LG_ CU302306.7 Danio rerio protein_coding NOVEL, 1363 bp
TCTCATCCCACTCCCGCGCGAGAGCAAATTTACAGCGCAC
TTCAGCTGCACGAGACAAACAGCAGCAATTATCTCGCGGG
AAAGAAAGAGAGAAAGAAAGAGCGCGCGACACCAAACATA
CGGCAGATCGGCGACGCGAGCTCTGAGAACAAACAAGCTG
AGCTTTCACAGTCCACAGTAATTTCTGGCTCAAGGAGGAG
GAGGAGGAATAAAAAAGACACTGACATCTCCAGCAAATGT
GAAGCTTGAGAGACGCATTGTGATATGGAGCTGCGAAGGT
TTTCATGGTGCGGTTGAGGACGTTTAAAGGAACAGCGTTT
AAACGACACTTCATCTTGTGGACCTTTTCTGACAGGTCAT
TGTTTTAAACGCCGACGTTTTTTAAATAGGACTACGTGTT
GAAAAGGACTTTTGGTCGCCTCAACAAGTTTTTTTCTGCT
CCGATTGACTATATGAGATCTCCGAGCTTGTCTTCTCCCT
CACCTTTAAGGAACTGTTTATGAACGGTCATTCAGGATGT
TGGTAACTCTGCAAAAAAGGATATAAAAAGTGGAACATTT
TTCTTTTATCAAGAATTCGACTAGCGTGAGACAATACGTG
TTACCACAGGGCATTTGTTGTTTTCCTATTAATTCTCGTA
TAAGACGCAAAAAGTCGTCGAAAGTCACTTCACGGATTCC
CTAACAGTTCGTTTAAAACTCCTTCATAAAGCTCGTGCAC
GTCTCGTTCAAGCATCGTCACTTCTGCAGATGTGCTCTGG
TTCAATTTTAACTATCGTGTAGGGTGTTGATGGAGAGCCT
TTCGAATGACAGCCGGGACAGTGGTAATCACAGGTGGAAT
TCTAGCTACAGTAATCTTACTGTGCATTATCGCTGTACTG
TGTTACTGTAGGCTGCAGTACTATTGCTGTAAGAAGGAGG
AGTCGGAGTCAGAGGAGGAGGAGCCTGACTTCGCCGTCAC
GTCTCGTATGCCGCCGGTGCATTCAAACCACAACATCCTG
GCAGCCGCGGTTCCTACAGCAACCACCCCCAATGGCCCTG
CCCTCTTTACCCCCCCACCGGCTCGAAAACTGACCCGCTC
ACAGACATACTGTCCATCCTGCACACATTACGACCTGCCG
TTTTACCTGCAGCAGCCAGATGGCCTGCGGAATGGCGGCG
AACGCATTAGCTACCGCGGAATGCATCAACAGGATTTGGG
TCTGCCCACTCCGCTGCCTGTCCAATTGCCTACCCCTATA
CCCACCCCACTGCACAGCCAGCTGCCAACGCCACTACCCA
ACTACCACAAACTAAACCTCAGCCGCTCAGTCACCATGAG
GGAGATGTTCACACGAAGCTGCAGCATTAGCACTGACGTT
TAG

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
fam163b-201 Contained in:

Genome Resources: Vega_Trans:OTTDART00000042919 (1),  Ensembl_Trans:ENSDART00000136853 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES No data available
CITATIONS (2)