Transcript

purg-202

ID
ZDB-TSCRIPT-091110-1533
Name
purg-202
Previous Names
  • purg-001
  • rhof-003
  • dkeyp-73e12.7-001
  • ottdart00000042850
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000042850 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000042850|OTTDARG00000030844|ZDB-GENE-070702-3 purg|OTTDARP00000034018 DKEYP-73E12.7-001 LG_ BX537303.10 Danio rerio protein_coding NOVEL, 1320 bp
CTCCTGTGTGCTGGAGGGAGGGGGGATTGGGTCATTGAGT
TCATTCGCACTACAGCAGCGGCGCCCTCCATAGAGATCCG
CTGTCTCTCTCTCTCACTCTCACTCCAGCTGGCAAGAATA
TGTGTCAGATGGATGGTGAGGCGAAAAACAAGATCTTTTA
AAATATGGTGCAAACGGTACGTGCCTCCGCGCTTCGCTTG
ACCTTTCATCAGGACAAAGGAAGTCGATGAGCCGTTTTAA
GCGGAGCCGCTGCTGCTGCCATTTTCGGGTCAATCGAGGA
GACTCGCCGGAGCTTGAGCTGTCGATAAGCGGAATAATAC
AGAGCCGAGAGATGGAGCGCCGTGAATGATTATGGCCGAT
AGTCACCGGAGGGCAACGGATAGAGGCAGAGGCAGAATGA
CATCAGGATACTCGCAGCAGTTTGTCAGCAGCAAAGCGTC
AGACATTCAGGAGCTCGCGTCCAAGCGCGTGGACATCCAA
AAGAAGCGCTTCTACCTGGACGTGAAGCAGAGCACCCGCG
GCCGCTTCCTGAAGATCGCCGAGGTGTGGATCGGCCGTGG
GAGACACGACAACATCCGCAAGAGCAAACTTACGCTCTCC
ATGTCCATGGCACCCGATCTGCGCTACTGCCTGGGAGACT
TCATCGATTATTACGCGCACATCGGGCTCCGAGGATGCCA
GGCGGCGGAACGCCGGCCGGAGGAGCAGAGCAACGGCCAG
GGCCGCGCGCCGGACCCTCGCCGGAGAGCTGAGCAGGCGG
CGTCACCCAACGGCTCCGGTGCGTCCGAAGAGCAGACGCA
CCGGGTGCTGAAGAGCGAGTTCATCGAGCGGGACAACAGG
AAGTACTACCTGGACCTGAAGGAGAACCAGCGCGGACGGT
TTCTGCGCATCAGGCAGACCGTCACCCGAGGACACGGGAG
CATGGGCTACTACGGCCAGGGCATCGAGCAGACCATCGTG
CTGCCCGCGCAAGGGCTCATCGAGTTCCGAGACGCGCTGT
CTCAGCTGATCGACGACTACGGCGACGACGAGCCCGAGCG
GGCCTGCGCGCGGAACCACGATGAGTCTCCAGAGCTCCCC
GAGGCGGCGTCGTTCCGCGTCGACAACAAACGCTTTTACT
TCGACGTGGGCTCAAACCGGTTCGGCGTGTTCCTGAAGAT
CAGCGAGGTCCGGCAGCCCTACAGGAACACCATCACCGTT
CCTCTGAAAGCCTGGGCGCGATTCGGCGAGAACTTCATGA
GGTACGAAGAGGAGATGCGACACATCTTCAGCTGCCATAA
AGAGAAGAGGACAGACACGGAGGAGCAGGAGGATTGACGC

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations