ZFIN ID: ZDB-TSCRIPT-091110-1352
Transcript Name: si:ch211-262e15.1-201
Previous Names: ch211-262e15.1-001, ottdart00000045008, prpf39-006, si:ch211-262e15.1-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000045008 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000045008|OTTDARG00000032261|ZDB-GENE-030131-5310 si:ch211-262e15.1|OTTDARP00000035585 CH211-262E15.1-001 LG_none BX539347.17,FP326646.4 Danio rerio protein_coding NOVEL, 3489 bp
CCCCCTTCCCTTTCTCTCTGGTGAATCGCGGCGGTGGGTC
GAGTCGCCGCCGCTGATGCTGCTGCTGGTGGAGTCTCCGG
TCGGGCACGTTGAACGTTTTTGATTTTATTTTCTCCCCCC
TTCATATTAAACTAACCGCGTGTGCCCCCCGAAAAGATAA
AGATGGCAGCGATGGCCCGTCTGGAGGGCCGCGAGTTCGA
GTATGTGATGAAGAAGCGCTCCGTGACGGTGGGTCGGAAC
TCGTCGCAGGGCTCGGTGGATGTTAGCATGGGCCACTCGA
GCTTCATCTCCCGCCGGCACCTGGAGATCTTCACCGCCGC
CGCTGAAGACACCGGCTCGGGCCCCGGAGGAGGAGATTTC
TACCTGCGCTGCCTAGGCAAAAACGGGGTGTTCGTGGACG
GGGTGTTTCTGCGGCGGGGGGCGCCACCCCTGCAGCTACC
GAGAGTGTGCACATTTCGGTTCCCCAGTACGAACATCAAG
ATCACGTTTACGGCGCTGGCGAGTGTCAAGCGAGAGAAGA
GAGAGCCCGAGTCTCCAGTCAAAGCAGTTCAGCCTCAGAT
CTCACCTTTAACCATCAACATTCCTGATAACATCGCTCAC
CTTATGAGTCCTCTGCCCTCACCCACCGGCACCATCAGCG
CTGCTAACTCGTGTCCATCCAGTCCTCGTGGAGCAGGATC
GTCAGGATATCGGCTGGGCAGAATCGTGCCGGACCTGCAG
CTCATGAACGACAACTCGCAGTCTGAAAATGACAAAGAAA
CATCAGAAGGAGACAGTCCAAAGGATGACTCTAAACCGCC
GTACTCGTACGCTCAGCTGATCGTTCAGGCCATCACGATG
GCGCCGGACAAGCAGCTAACACTAAATGGCATCTACACAC
ACATCACCAAGAACTACCCCTATTACAGGACAGCAGACAA
GGGCTGGCAGAACTCTATTCGTCATAACCTGTCTCTGAAC
CGCTACTTCATCAAAGTGCCGCGCTCTCAGGAGGAGCCAG
GCAAAGGTTCGTTCTGGAGGATCGACCCGTCATCTGAGGG
CAAACTGGTGGAGCAGGCCTTCAGGAAACGCAGGCCACGG
GGCGTCCCCTGCTTCAGGACCCCACTGGGACCCCTGTCAT
CCCGGAGTGCACCGGCATCGCCCAATCACTCGGGCGTTCT
CTCCGCCCACTCCAGCGGCGTTCAGACTCCTGACAGCCTA
TCACGTGAAGGCTCTCCGGTTCCCATGGAGTCAGAGCCCG
TCTCTGTCCCACCCCCTGCTGCTGTTGCTGTTGCCGCCGT
CCAACCCAAGCTAGCAGTAATTCAGGAGACCCGCTTTACC
CAGAACACCACAGCGTCTCCCATCACCACGCAGCCGGTGC
TGATCGCGGTTCAGCGTCCGCTCACTCAGAACATGAAGCC
GGTGACGTACGCGGTGGCAGCTCCCGTATCGTCCTCCACG
TCTGCGCAGCCGCTCATGCAGACTGTGCACGTGGTGCATC
AGATCCCTGCGGTCGCCGTCAGCACCGTCAAAACTGAGCC
GCGGGAGAACGGAGACTACGACGAGCTCAAAGTGAAAGTG
GAGGCGGTTCCTGGCATTGCTCATGGCTCCATAGGAACAG
CCAATAGGGTGATCCAGACCAGCGCCGCAGCCACGCCCCT
TCAGACCGTTACTATAGTGCAGCAAGCCCCATTGGGCCAG
CACCAACTGCCAATCAAAACCATCACCCAGAACGGCACTC
ATGTTGTGCCCATCGCCACGGCGATACAGAGTCAGGCCAA
CACAGTGTCGAGTCCGCTTCACCTGTTGGCCGCTCACGCC
TCTGCGTCCGCCTCTCTCCCCACAAAGAGACAGAACGGAG
AAAAAGCCAGTGATCCACCAGAGAGCAAACGATTGAAGAC
TGAAGACGAAGAGCAGAAAGTCAGCTCAGACCCCAACGGA
AGCGCGGCGGACACAGACTCCGCCAACCACAACTAGTTTA
ACACCACCCTTCTTCTCTGTTTATCTCCTTTCCTCTTTCC
CATTCTCTCATCACGGTTTCTCTTCCATCCAGCTCACGGT
GCCAAAACCTGAAGGCTTTCACTCCGGACTACACTCTGAA
GCCAAGCAAAAAATGTCAACAACAACCAACAAACAAAAAA
AGAAAACCAAACGCATAGAAGAGCGTCCGTCATCAGCGTA
ATCTCTTCTTTTTTTTTTTTATTCTTTTTTTTTCAGTTTT
ATTACTCAAGAAGCCTGACTGAACAAGAACTCGCGCCTCC
AAAAATACAAAAGCGACTGCCATCTGGTTTATAACCGGGC
ATTTTATGAAGACTTTCAACAGATGTTCTCCAATCAGAGG
GCTCAGATTGCGTTCCTGGGACATATCTAGCATCTCACAG
CCAAAACTGGACGGAATCCCAGAGGTTTAGCGAACATGCG
ATGCGCGTAGATGTTCATCCCATCTGCAGAGATTCTAGAA
CCCTCAATTTAGAATGTGAATTCCAGAACTCCAGCGGAAC
ACGGGGCTGCGTTCCAACATTCCAAAAGTGTGGCGTTCGA
ATCGCAGGAGGGCGAAAAAAAGCCGAGAGGATGTCCTGGA
ATGGAATTACACACCATGAACCACACATACGTTATTTCTG
TTGTTGTTGTTTTTTTTTTTTTTTGTATAAATAGTGCATA
CTAGGGCTGTACTTGGAGACCGTCTTCAGCCAAAGGGATC
AAAATATTCCGAAAAAATTCCTAAACTTTCGGCAGCTAGC
CTGACAGCGTCCCACACAATCCCGTTTGCAGCAGTCGTAG
TGGATAATATGCAGTATTTTGTCATTCATATGTGGAGCGT
AGGGCGTGTTTTCGTTTCTAGAGACGTTTTAAAAAATAAT
AACAATAAGGATATATATATAATAAGCAGCAGCAGCATAG
GAGCAGAAGAGGACGTGGGACGTCTGGACTGTGTCTCTTT
TCTGTTTTGTGAAACTGTGTAGTTTCTTTTCTAAGATGGA
GAAAAAAAACAAAGTGTATCAGTGGAGTATTTCCTTCCTT
TTCCGTTTTCTTTTTAAATCGGAGCTTTGTCACATTGACA
TTGTTTTCATCCTCGCACAGATGCCCGAGTGGACTCGTCA
TTTCCGTGTGTACTTGAGCTGTCATCATTCAGCTTGCATG
TGACAGACTAGACAAACAAACGTACCTGAGCCGTCGACTT
AAACGTGTAAAAAAAAAAAAGAAATAAAACAAGAAATGAG
AACCTGCTTTGAATCGGACCACAGATCTGCACTTGATTCG
ACCGTTCTTCTGTTGACTTTCGTTTCGTTTCTTTCGTTTT
TTTTCTCTCTGTTTGGTTCCCCTTTTTGTTTTTAGGCTGT
ATTGGTGTAGGCCGATTCTGTCTGCTTAATGATTTGATTC
GGGTCAGGCCGGCGAGTCTGACTGATTATATATGTTTCAA
ACAAAAGCAAAAAAAAAAATTATATGATTGATGTTTGTTC
TGCTTCAGTGGGTCAATGCTTTTTTTTATAAATTAATTTA
AAACCTTAA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
si:ch211-262e15.1-201 Contained in:
[BAC] CH211-262E15 (1)
[Fosmid] CH1073-236F5 (1)

Genome Resources: Vega_Trans:OTTDART00000045008 (1),  Ensembl_Trans:ENSDART00000018159 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:BC068417 (1) 2981 nt
GenBank:BC054664 (1) 2442 nt
GenBank:CK356504 (1) 791 nt
GenBank:CD755204 (1) 755 nt
GenBank:BM035907 (1) 579 nt
GenBank:EB780967 (1) 548 nt
GenBank:EB958972 (1) 230 nt
CITATIONS (2)