header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-091110-1321
Transcript Name: cebpz-201
Previous Names: cebpz-001, ch73-78m17.5-001, dkey-167k11.5-001, ottdart00000044882, zgc:112104-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000044882 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000044882|OTTDARG00000032175|ZDB-GENE-050417-261 cebpz|OTTDARP00000035510 CH73-78M17.5-001 LG_none CU550712.7,CU570797.18 Danio rerio protein_coding NOVEL, 3366 bp
GAAGAAGAACACACGCGCACACACAGACGGAAGTGAACGA
CGAAGCATGCGCTAAATGGTCATGGAGGTGGACGATCAAC
ACTCGTGTCAGAAAAGCAGAGAAAACATGGACGCTGAGAA
CGAGGATTTTGATGATGCTGAAGACAGCGATCACACCGAA
AATGACAAAAAGGATGACGAGCTCACGCTGGACAACGTGC
TGCGTTTGGGCGGGACGAAAGCAGATTATGTCATGCTGGC
TGGCATCAGCGACACTACCGAGCTCATAAATGGTGGGAAA
AAAGTCATAATTGATGATCTAGAGGAGGGAGAGCTGGAAG
ATTTCATAAAACAGCTGGGCATCCGTGCATATGCAGATCA
GCAAATCATCCAAGATGAAGAGGACCCAGCATCCTCAGAG
CCAACTCAAAAGGAGGGAAAAAAAGCAAAAGGTTCCAAAG
TAAAAGAGGATGCAGCACCTAATGTGAAAAATAAAGTCAC
CCCCTCAACACAAGCGACGAAGACGTCTGTTCAGTCTACA
AACCTTGCCAATGCCACTGGAAAGAAGGCCAAACAAAAAC
CCGCAAACCTGTTTGAGTTCATTCCAAGGCAATTTCTCCT
TATTAAACCTGGGGGGAAGTGGTTCGATATCGAGTACACC
TCAGAAGGCACGTCTGTAGCTCAAAATGAGTCTCTGACCT
GTCAGTACAAGGCTTTAGCTCAGAAGCTCTACGAGAACGA
AACTGCCCTCTACAAAAGCAAGAAGAGCCTTCAGAAAGGT
GCCAACTCTGCCTGGATGAAGACCGTAGTGTCCACAGGAA
CTATGACCGATAGGATGGCAGCTATGACCGTGCTGATTCA
GGATGCTCCAGTTCACAGTCTCGAGCACATCGAGAGCCTC
GTGTCCATGATGAAAAAGAAAGGAAGTCGTAGACCTGGAC
TTATGGCGTTGGACACCCTTAAGGAACTGCTGCTGTCTGA
CCTCCTCCCAAAAACCCGCAAGCTTCGGACGTTCTCTCAG
CATCCTTTTGAGGAGCTGGAGGAAAAATCCAGTGGCAACA
AGGACACCAGGGACCGCAGGCTAATTCTCTGGTACTTTGA
GCACCAGTTGAAGCTTCAGATTGCAGATTTTGTGGTCACT
TTGGATGAACTTGCTCACGATATGGTCGAGGCCACCAAAA
TGCGAGCGCTTACCACTGCCTATGAGCTGCTGTGCAACCA
GCCAGAGCAGGAGAAGTTGCTTCTCGTGCAGATTGTCAAC
AAATTAGGGGATCCCGAATACAAAACTGCCTCAAAAGCCT
CATACTTGTTAGAAACGGTGCTTCACAAACATCCCAACAT
GAAGACGGTGATCTGCTGTGAGATCGAGCGCCTCATGTTC
AGATCCAACATCAGCCCCAAGGCTCAGTATTATGCCGCAT
GCTTCCTAAATCAAGTGATTCTGAGCCACGATGAAGCAGA
CTTGGCTGCCAGGCTCATCACCATCTACTTCACGTTTTTC
AATGCATGTGTTAAGAAGAAGAATATGGAATCGAAGATGC
TGAGCGCTCTGCTAACTGGAGTGAACAGAGCTTATCCGTA
CGCTAAGATTGGGGATGACAGTGTATCCAAGCAGCTGGAC
ACGCTGTTTAAAGTGGTGCATGTCGTCAAATTCAACACTG
CCGTCCAAGCCCTCATGCTGCTCTTTCAAGTCATGGACTC
TCAACAGACTGTTTCAGATCGGTATTATGTAGCACTCTAC
AGGAAATTGTTGGACCCAGGATTATTTTCAAGCTCAAGAA
AGAGTATGTTTCTCAACCTCTTGTATAAATCTCTAAAGGC
TGACATAGTTCTCAGGCGTGTGAAGGCATTTGTGAAAAGG
CTTCTTCAGGTCAGCTGTGAGCAGACTCCTGAATTTGTAT
GCGGTGCACTTTTCCTTGTGTCGGAAGTGATGAAGGACAA
GCCAGGCCTCAAGCTGCTACTACAAGAACAGGGGGAAGAA
GAGGAAGAGTTCTATCAAGACCTCGAAGAGGATCTAGATG
ATAACGACACTGCTGCGGAAACTCGTGTGAATGATGAAAA
AGACAAAGGAAAACCATTTACAAAACATTGTCATGTGAAG
CCCACTGCATCATGGGTACATCAGCAAAATTTGGAAGGTG
GTGTGAATAAGGCAATCTATGATCCCATGAACAGAAACCC
TTTATACTGTGGGGCTGATCACACAGCCCTCTGGGAACTT
CAGAAGCTGTCTCATCATTTCCATCCCTCCGTGGCTCTTT
TTGCTAAAACCATATTGCAGGGAGAGTTCATAGTGTACAC
CGGAGATCCACTTCAGGACTTTACACTTATGCGATTCTTG
GATCGCTTTGTTTTTAGGAATCCAAAGCAAGCAAAGGGAA
AGCAAAACACAGATGCTATTGTGATGCAGCCTAAGTGCAG
GAGGACATTCGGTAATGTGCAGCCATTACCTGTTAACAGT
GAAGAATATCTGGCCAAAGAGGAGAGTCAGATACCTGTGG
ATGAGGTGTTCTTCTACAGGTACTTTAAGAAGCGAGATGA
GGAGAAACGATGGAAAAAGACTAAACGAAATGAGGACAAC
GAAAGTGTGGAGGATGTTGATGATGATGAATTTGAGAGGA
TGCTTGATACGTATGAAGGAGACCGCTTTTTCACCGATTT
CAAGGATGATGACTTGGACTTTGCGAGCAGTGTGATGGCT
AAGTCTAAGAAAGCTAAAGATCAAGAAGAAGATTCTGACG
ACGATGATGATGATGACGATCTTGATGATGAAGAGGTCTC
TCTGGGCAGCATGGAAGACTTTGAAGATGAATGTGAGGAC
GAAGCTGGAGAGTTCATGGACGTAGAAGATGATGCTGAAG
CAGGCGATCAACATGGAGAGAAGAAAAAGAAAAGAAAGAT
GAAGGACCAAGCAGTGTTTGCATCAGCTGAAGAGTTTGGC
TGTCTGTTGGATGAAAACGCAGGTCTCAAGTTTGATAACA
GCGGCATGAATGCAATGTCCAATGCAGACAAAGCTGGTGT
TAAGCAGCTGAAGTGGGAAGCTCAACGCAATGACTGGATC
TGTGGTAGAGATGTCAAAACTCTCCGGCGGAGAAAGGCAA
ATTTCAACAAGAACAAGTTTGGAATGGCCAGAAAGCATAA
GAGTGTCAAGAAAACGAGAAGGTAGAATAAAGATGTCTGT
TTATACTCGCGCCAGATTGGTGGACCAGACTTCTTGATCT
GCTTCATGGATGCATTGACAGTCGCAGTGATGTACAGGAG
AGGAGGAACTGCTTTGCTATATTTCTGTATGATTGTGGCT
CTACAGTGGTTTAGTCAATATTGGCTGTTTTATACATTTT
CAATGGTTTATCATATCCAGGGGTTTGTCCATGCTTTGGA
AAATGC

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
cebpz-201 Contained in:
[BAC] CH73-78M17 (1) (order this)
[Fosmid] CH1073-412H12 (1) (order this)

OTHER cebpz-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000044882 (1)
  • Ensembl_Trans:ENSDART00000099315 (1)
  • PROTEIN PRODUCTS No links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:CN024878 (1) 920 bp
    GenBank:CO925547 (1) 799 bp
    GenBank:EX154809 (1) 700 bp
    GenBank:AL725314 (1) 696 bp
    GenBank:EV563456 (1) 486 bp
    GenBank:EX159504 (1) 486 bp
    CITATIONS (2)