ZFIN ID: ZDB-TSCRIPT-091110-1268
Transcript Name: abcd4-202
Previous Names: abcd4-002, dkeyp-72f10.4-002, ottdart00000044604, rp71-18a8.1-002, zgc:153503-002

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000044604 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000044604|OTTDARG00000031992|ZDB-GENE-050517-30 abcd4|OTTDARP00000035247 RP71-18A8.1-002 LG_none BX293567.21,CR792456.6 Danio rerio protein_coding KNOWN, 2193 bp
ATGACTCCTATGAAGCAGAGCAGTGTTAAAAGACCAAAGC
TAGATTGGAAGTTTCTCCAAAGATTTTACAGCATTTTAAA
AATCCTTTTCCCATCCTGGTCCAATCAGAACGTCCGAATG
TTCATGACCCTTCTTGGCGTCACACTTTCAGTCCAGCTTG
TGATTTATCAAGTGGGTCTAATTCCAAGTCAGTTCTACAG
GGTTCTGTCTGAAAGGAGTTATGGCAAGTTTAAGGATCTT
GTGGTGTTTGCAGTTGTACTCATCCTGATTAATTCAACGT
TGAAGAGTCTGGACCAGTATATCTGCAGTTTGCTGTATGT
CAGATGGAGAAAGACTTTAACTGAAGATCTCCATCACCTA
TACTTCAAGGGACGCGTTTACTACACCCTCAACATACTGT
GCAAAGACATCGACAACCCAGACCAGCGCATCAGTCAGGA
CGTGGAGAGGTTATGCAAACAGATGAGCACTATGGCGAGT
CGACTTCTCATAACGCCATTCACTGTAACCTACTACACCT
ATCAGTGCTTCAACAGCGCGGGCTGGATTGGATTTGTCAG
CATCTTCAGTTACTTTGTGGTGGGAACCATCATCAACAAG
ATCTTAATAGGACCAATTGTTTCCATGCTGGTGGAGCAGG
AAAAGCTGGAGGGCGATTTTAGGTTCAAACACATGCAAAT
TAGAGTGAACGCAGAGTCTGCAGCTTTTTACAGGGCAAGC
AATGTGGAACACATGCGGACCGACCGAAAGCTACAGATGC
TTTTGTCAACTCAGAGAAGCTTGATGAACAAAGAGCTCTG
GCTCTACCTTGGGGTAAACACCTTTGATTACATGGGCAGT
ATCCTCAGCTATATAGTCATCGCAATCCCCATCTTTGCTG
GCAATTATGACCACCTGACACCTGGAGAACTGAGTGCACT
TATCAGCAAGAACGCTTTCGTCTGCATTTATCTGATCAAC
TGCTTCACCCAGCTCATAGATCTCTCAACTACAGTGTCTG
ATGTCGCCGGATACACCCACAGAATTGGTGAACTGCAAGA
AGCAATGGCAGATATTGCTAAGAAACAGCGTGATGAGTAT
CAGTATGATCCAGTGTCTAAGGCTGAATCTAACAGTGATC
GGGAGCTCCAGAGTGTTCCGGCTGACACAGCATTTGTGCT
TGACCGCCTCTGCTATAAATCTCCCCTCTCAGAGGAACTG
CTGGTGAAAGATCTGACCCTGAGTATTAGTCAAGGAACAC
ACTTACTCGTGGTGGGAAACACGGGTACAGGGAAAACCTC
ACTACTGAGGGTCTTGAACAGCCTGTGGGAACCATGCAGA
GGTTCTGTGCAGATGACCACATGTTTTGGACCAAGGGGTT
TGATGTTTTTGCCACAGAAAGCTTATCTTACTGATGGCAC
ACTTAGAGATCAGATTATCTACCCGTTAAAGGACATATAT
CCTTCCTCAGGTTCTATAGATGATGAACGAATATTAAAGT
ACCTGGAACTTGTTGGTTTGTCGAATCTTCTGACCAGAAT
TGGAGGACTGGATACAGAAGTTACTTGGAACTGGTATGAC
GTTTTATCCCCAGGAGAAATGCAGAGGCTTTGCTTTGCTA
GACTGTTATACCTGCAGCCCAAATTTGCAGTTCTGGACGA
GGCCACTAGCGCTCTGACAGAGGAAGCTGAAGGCCAGCTC
TACAATGCCTGTAAGCAGCAGGGAATGACCCTAATCAGTC
TGGGCCACCGAAGCACTCTGGAAAAGCACCATGATGTCAT
GCTGCGACTGTGTGGAGGTGGCCAATGGGAGCTCAGCAAA
CTCAAAGAGCCATGAACTGCTCTAATGAGAGAATTTGGGT
TCGCTTTGTGGTTCTGAGTGCAGTCATCCTTGAGACTCGA
GAGAAATCTTGCCATGTTTACTTCACAGTATACTGCGATT
TACTGGAGCTACTGATACACTAATAATGCAGTCTTATTAC
TACTGAACTGTATGTCTCAGCATTCTTTTTGTCGTATACA
AGTTGTTTTTGTTATGTGTATGCTGCTTTGTATATTTCTT
GGGGTTTGGAAAAAGGGATTTTTGTAATGAAGGACATTGA
ACTGTATCCCAAAAATAACTTTAGAAAAAGTAACCTATGG
AATATATTTAAGATATACATTTTATAAATATAAAGTATTT
GATGAACTTGCTAATAAATAAATAAAATAATCT

abcd4 TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA abcd4-201 (1)    Ensembl 1252
abcd4-202 2193
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
abcd4-202 Contained in:
[BAC] DKEYP-7A3 (1), RP71-18A8 (1)

Genome Resources: Vega_Trans:OTTDART00000044604 (1),  Ensembl_Trans:ENSDART00000129679 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:BI984210 (1) 578 nt
CITATIONS (3)