Transcript

cbln2b-201

ID
ZDB-TSCRIPT-091110-1222
Name
cbln2b-201
Previous Names
  • cbln2b-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000044434 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000044434|OTTDARG00000031896|ZDB-GENE-070615-12 cbln2b|OTTDARP00000035130 cbln2b-001 LG_ CU929414.5 Danio rerio protein_coding KNOWN, 1597 bp
GCACTCTTATTGGGCGCGCGCTTCACTCCTTCTCAAGACA
GCTGAAGGAGCAGCCACACCGACCACACCAACTATGGATT
TAACAGGAGACGTTTCAAATACTTTGAACACCTCCAACTG
ATGCGCAAAGACGAGAAGAAACGGAGTGTGTGACGGCGAG
TTACAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAG
AGAGAGAGAGAGAGAGAGAGAGAGGTTAGTTTGGACCAGG
TGATAGAGCCACATCAAACCTCCAAGGGGCTGGTGGTAAA
GATCAGTTTGCACAGGATTCTTGTTCCGATCATGGTGCCA
GCAGCCTGTCCCGGACCCTTTGCCATGCTGGCTCTCGCCT
TTCTCCTGGGATGTGGCATAGGGCTCTGTCTGGGCCAGAA
TGACACCGAGCCCATCGTTCTGGAGGGAAAGTGTCTGGTG
GTGTGCGACTCCAACCCCTCTTCTGACGGAGGAGTCACCT
CTTCGCTCGGGATATCTGTGCGTTCCGGCAGCGCCAAAGT
GGCTTTTTCGGCTGTCAGAGGGACAAACCATGAACCTTCG
GAGATGAGCAACACATCCATGACCATTTATTTTGACCAGG
TCTTAGTAAACATTGGCAATCATTTCGACCTAAAGGCGAG
TCTGTTTACCGCGCCACGGAGAGGAATATACAGTTTCAGC
TTTCATGTGGTCAAGGTCTACAACAGACAAACCATACAGG
TGAACCTGATGCAGAACGAATACCCGGTCATTTCTGCTTT
TGCTGGGGATCAGGATGTCACGCGGGAGGCAGCGAGTAAC
GGAGTTCTACTGATGGTGGAGCGCGAGGATCGAGTCTATC
TCAAGTTGGAAAGAGGGAATCTAATGGGCGGATGGAAATA
CTCCACGTTCTCTGGATTTTTAGTCTTTCCTCTATAACTG
AATCGCAAAACGCGATGTTTTCAAAAGACCAAGTTCTTTG
AACAAGACTGAAATAACACAAAACTGCATATGGACGCGCC
CCCAGGGAGTTCCCGCCTTTTTTGGCTGTCGCGATTGTTC
TTGGATTTTATCAACAGGAAACAATCCGCAACTGACAATT
ACCTGGACCACTATATAAATGAGAAGATATTTATGACGAA
GACGAACTTCAAATCCCGAACTAGGTGTATTTATCAGTGC
TTTATTTTGTGTTTGTATAGCCTTAATGATTCGGCTTCCG
TCCAGTGAGGTGTGTGGTGTGGAGCTGCGGAAGTGCTTTA
TGGCCCCAAAGCATTTTTGCACGAATGAAATGGAAGATTC
CTGTTTTGTGCTGTCAATGATGTGTCGTTTGGATGCTGAA
CATACTGAAAATAAGCCAAATGTAGGCCACCTGCTATACA
GTGATTATTAATAAGAAAAAAGATCATATATCAGCCAATG
GAGACGTCTTAAAAACTTTTTTTTTTTTTTTGCTAGACAT
CTAATTTCTAAAATACATATTTACATTATGGTGTGTTCTA
CATTCCGGATAATACGTAGCTTTGATTGATTTAGTGTTCA
GTGACAATGCTCACAGATGTAAGTTGTGGAAAAAGAAAAG
TCCCTATATAATGTCCCGCCTAATAAAATATTGTATT

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations