ZFIN ID: ZDB-TSCRIPT-091110-1212
Transcript Name: si:ch211-69l10.3-001
Previous Names: ch211-69l10.3-001, dkey-149l16.2-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: ncRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000044385 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000044385|OTTDARG00000031862|ZDB-GENE-091204-106 si:ch211-69l10.3|no_translation CH211-69L10.3-001 LG_ CT573344.8 Danio rerio sense_intronic NOVEL, 825 bp
ATTTATTTTTTATTTAGGAGGAGTGACTGAGTCGTATTCA
TTCTTGTTCTATAAATGTAAGTCTGCAGCTCATACATTTT
AAAGTGATGCATAGATTACACTATACTAAAGCCAAACTTG
CTGTATCCGACCATCTCTTCTCTGTGTGATAAGTGCAAAG
GCTTAGTTGGGACCTGTGGTCATATATTCTGGTCCTGTCC
AGAAGGATCTGAATTTTGGAGAAGTATCTTAGGACTTTAC
TCCCAGGCTTTTGACATGAAAATTAAAATTTATGTGGACA
TAGCACTGTTTGGATGTTCAGACTAGGTTCTAACTTGGCC
TAAACATCAACAACTCTCCCATGTTTGGCATGGTGCTGGC
CAAGAGAGGGATTGAGATGGAGTGAAAATCCTTGACACCT
CCACATTTTTTTAAATGGTTAGCTGAAATTATTTCTGCCC
TTAAGCTGGAAAGGTTACGTTACTCTAGATTTAGCAAACA
GAAGTTGTATGCCAAAATATGGGGCCCCTTCATTAGATGT
ATAAGTTAATAATGTTTTTGTAATAATTTATTTTTGTTAA
TATTTTTTTCTTTTTCTCTTCTCTTCTCTCTTTTTACATG
TCATTCTATGTTGTTTCTTATTCCATTAATCTGGCTGAGA
CTTTTTTTTAAATGTTTTTTTTTATTATTATTTATGGTGC
TGTATAATTACTGTATTGTTTGCTAGGGTTTTGGTGCATG
TTCTAGTTAGTACCAGGTAGTCACACTAAGATAATTTTGT
TAACAGATATATAGATGTACACTATTTGGTCTTATGTTTT
TACAAAAACTTCTATGAATAAAGTA

SEGMENT (CLONE AND PROBE) RELATIONSHIPS
si:ch211-69l10.3-001 Contained in:
OTHER si:ch211-69l10.3-001 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000044385 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:CV489682 (1) 876bp
    GenBank:CT664637 (1) 791bp
    GenBank:CT660950 (1) 773bp
    GenBank:CT685108 (1) 631bp
    CITATIONS (1)