ZFIN ID: ZDB-TSCRIPT-091110-1193
Transcript Name: actr3b-201
Previous Names: actr3b-001, dkey-148g10.1-001, dkey-149i7.1-004, ottdart00000044289, zgc:158823-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000044289 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000044289|OTTDARG00000031782|ZDB-GENE-070424-10 actr3b|OTTDARP00000035056 DKEY-148G10.1-001 LG_ CU466274.8 Danio rerio protein_coding NOVEL, 1275 bp
TACGTTAGTGCTGGTGATGGCAGCAGCTCGGCCCCCTCCA
TGCGTGATTGACTGCGGGACAGGGTACACCAAGATTGGTT
ATGCTGGAAACACAGAGCCCCAGTTCATCATGCCAACTTG
TATTGCGGTCAGAGAGTCAGCCAGTGTTGGAGATCAGGCA
CAGAGACGTCTTGTGAAAGGGGTGGATGACCTTGATTTCT
TTATTGGAGACGAAGCCATCGATAAGCCCAACTATGCAAC
CAAGTGGCCCATCAGACATGGTATTATTGAGGACTGGGAC
TTCATGGAAAAGTTCATGGAGCAGGTCATATTTAAATATC
TCCGAGCAGAGCCCGAGGACCACAACTTCCTGATGACAGA
ACCTCCTCTAAATACCCCAGAGAACCGGGAATACTTAGCT
GAGATCATGTTTGAAACGTTCAACGTTCCAGGGTTGTACA
TCGCTGTTCAGGCTGTTTTGGCATTGGCAGCATCTTGGAC
TTCAAGACAGGTTGGAGAACGAACGCTAACAGGAATTGTG
ATTGATAGTGGTGATGGAGTTACTCATGCTATACCAGTGG
CAGAAGGGTATGTGATTGGCAGCTGCATAAAGCACATCCC
AATAGCAGGCAGAGACATCACCTACTTCATTCAACAGCTG
CTGAGAGAGCGAGAGATCGGCATTCCTCCAGAACAGTCGC
TGGAGACTGCAAAAGCTGTTAAAGAAAGATATTGCTACAT
CTGTCCAGACATCGTGAAGGAATTCACCAAATATGACATG
GACCCTGGAAAATGGATTAAAAAATACAAGGGGATCAATG
CTATCAGCAAAAATGAATTTCAAATAGATGTCGGATACGA
GCGTTTTCTGGGACCAGAGATATTTTTTCACCCCGAGTTT
GCCAACCCAGACTTCATGCAGCCCATCTCAGATGTTGTGG
ATGAAGTGATTCAGAACTGCCCTATAGATGTCAGAAGACC
GCTATACAAGAACATAGTCCTGTCGGGGGGCTCCACAATG
TTTCGGGACTTTGGCCGCAGACTGCAGAGGGACCTGAAGC
GTGTTGTGGATGCCAGACTCAGACTGAGTGAGGAGCTCAG
CGGCGGCAGAATAAAGCCCAAGCCCATGGAAGTGCAGGTT
ATATCCCATCACATGCAGCGATACGCAGTGTGGTTTGGCG
GATCTATGTTGGCTTCTACGCCTGAATTCTTCCAAGTCTG
CCATACTAAGAAGGACTACGAGGAATACGGACCTAGAATC
TGTCGCCACAACCCTGTCTTTGGCATCATGTCCTA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
actr3b-201 Contained in:

Genome Resources: Vega_Trans:OTTDART00000044289 (1),  Ensembl_Trans:ENSDART00000045150 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:CN505470 (1) 805 nt
CITATIONS (2)