ZFIN ID: ZDB-TSCRIPT-091110-1117
Transcript Name: qpctlb-201
Previous Names: qpctlb-001, ch211-119c24.1-004, ch211-191j22.6-001, si:ch211-191j22.6-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000043967 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000043967|OTTDARG00000031577|ZDB-GENE-091118-40 qpctlb|OTTDARP00000034844 CH211-191J22.6-001 LG_ BX248087.10 Danio rerio protein_coding NOVEL, 1176 bp
ATGAAGAGCATACGGTACAAAGCAGCGACGGTCAGATGGA
GCTGCTCTGTGGCGCGCTGTGACCAGCCCCGCATGTGCCG
CGTCCGGTTACTGCTGCTGTGCCTGTGCGTGCTGGTGGCA
ATGACATTAACACTGGCATTATCACTAGCTAACCAGCACC
CAGAGGAGTTTGACTTACCACCAAAACCTCCTGACCTGAT
CAAAGACAAGCTGAATCACCAGCCAGGTAAACCCACTGTT
GCCCAAGTGAAGCGGCTCATCTCGCAGGTGAATTGGGAAA
GACTGTGGTATTTCCAGCTGCGACCCATTCTCATTCAGCG
ACAGCCTGGAAGTCGAGGAAGTCGAGCTGTTCGTAAACAC
ATCTTTTCTCAGCTGGATTCTCTTTCGGCTGGCTGGTCTG
TTGAAGTGGACTCTTTCATCTCTGAAACCCCGCGTGGCCC
AGTTAGCTTCTCTAATATCCTGGCTGTGTTGGACCCGATG
GCTCCCCGAAGACTGCTTTTGGCTTGTCACTATGACTCTA
AATTGATACCTTCAGACGCAAGTGAGCCACAGAAGGTGTT
TGTGGGTGCCAGTGACTCAGCCGTACCCTGTGCCATGATG
CTGGAACTGGTCACAGCTTTGGACGCACACCTGAAAAAGC
ACAAGCAGCTGATGTCCAGGGTGACCCTTCAGCTGGTCTT
CTTTGATGGAGGAGAGGCGTTCGAGCAGTGGTCTCCGACA
GACTCATTATATGGTTCACGGCATCTCGCAGAATACATGT
CCAGCATTCCTCATCCACCGGGATCTGAACAAACCACACT
TCTCAATGCCGTGGATCTCCTTGTCCTTCTGGATCTGATT
GGTGCTGCTGACCCTATGTTTGTGAATCACTTTGACAACA
CAGCTCGTTGGTTTGACCGCCTAATCGCTGCTGAGAAAAG
ACTTCACACTTTGGGGCTCCTGTCTTCCCATCCCAAAGAG
CAGAGGTATTTTATCAAGGATATGAACATGGGCCCAGTCG
AAGATGATCATCTTCCTTTTCTTCAGAGAGGAGTACCAGT
GCTACATTTGATCGCAACACCGTTCCCTTCATTCCTGCAC
ACGATGGAGGACACGGCAGACAAGATTCACAGACACACTG
TGGAGAATCTCACCAAAATCCTGGTGGTTTTCTTGGCTGA
ATATCTGCGGCTATAA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
qpctlb-201 Contained in:
OTHER qpctlb-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000043967 (1)
  • Ensembl_Trans:ENSDART00000089898 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:DY571940 (1) 818bp
    GenBank:BM181950 (1) 683bp
    CITATIONS (2)