ZFIN ID: ZDB-TSCRIPT-091110-1080
Transcript Name: ulk1b-002
Previous Names: ch1073-409b12.3-001, dkey-11o18.7-002, si:dkey-11o18.7-002

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: ncRNA
Annotation Status: retained intron
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000043833 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000043833|OTTDARG00000031492|ZDB-GENE-071203-2 ulk1b|no_translation ulk1b-002 LG_none CR450803.12,BX510645.8 Danio rerio protein_coding KNOWN, 502 bp
GTGTGTGTGTGTGTGTGTGTGTGTCTACGTATCTCCACAG
CTACACCAGTGACCGTGACATGCTTTCCCAATTCAGCCTC
TGCAAGCTCATGCAGCAGTTCATCTACTTCACACCTGGCC
TCTCCTCCTCAATCGCTTGCTGAGATCCAGCATGTCCGTG
CAAAGGCGTTAGCCTCCCCTACCCAGGATTCTCCAGGATA
TCTGCTGAAAGACTCAGGAGGAGGTGGAGGAGGCAGCAGT
AGCAAAAACTCATCCTGTGACACTGATGATTTCGTCATGG
TTCCAGCTCATTTCCCCAGTGAGCTTACCTGTGACATGCC
AACTGGAAAGGTTCTCCAGGACAGTTTGATGTATAGCGGG
AGTTCTCTTCTGGCGTCCGGAGGTCAGTGCAGTCAAGGAA
AGACTCCGCCACGCTCTCCATCATTCAGCAGCTCTCCAGG
ACCCAGCGGGTATGATCTGCCCTTTAAAACAAAAAAGAAA
GAAATAAACTACCAAAATGGCT

ulk1b TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA ulk1b-201 (1)    Ensembl 3573
ncRNA ulk1b-002 502
ulk1b-003 (1)    Ensembl 769
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
ulk1b-002 Contained in:

Genome Resources: Vega_Trans:OTTDART00000043833 (1),  Ensembl_Trans:ENSDART00000132276 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:EB991250 (1) 502 nt
CITATIONS (2)