Transcript

taar20r-201

ID
ZDB-TSCRIPT-091110-1055
Name
taar20r-201
Previous Names
  • taar20r-001
  • ch211-238p8.5-001
  • dkey-181m19.4-001
  • ottdart00000043719
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000043719 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000043719|OTTDARG00000031401|ZDB-GENE-060413-21 taar20r|OTTDARP00000034651 taar20r-001 LG_ BX530037.7 Danio rerio protein_coding KNOWN, 1053 bp
ATGAAAAGACAGAAAGGAGAGCAGAACAAACTCCTAACAG
GAGGAGACTCACTCATGGCCTATGAGACAGAGGATCTGGA
GACTCAATACTGCTTTCCTGACATCAACTCATCATGTGTC
AAGGAGAGACGCTCCAGTCATAGATTTGTTATCATATACT
TGTTTGTGTCATTGCTGTCAGCATGGACTGTGTTTCTGAA
CCTGCTGGTGATCATCTCCATCTCTCACTTCAAGAAGCTT
CACACTCCAACCAACATGATTATTCTCTCTCTGGCTGTAA
CTGATCTGCTTGTTGGACTCGTCATGCCTGTAGAGGCCAT
CAGAATGATTGAGACGTGTTGGTATTTTGGAGACACTTTC
TGTGGACTTCATTTATTATTTGTGTCATTACTTATTGCAG
CATCTCTTAGTAATTTGGTTTTAATTGCTGTTGATCGTTA
TGTGGCTGTGTGTCACCCTTTACTGTACCCACAGAAAATA
ACCATCACTAAAACACTTATGAGTATCTGTCTGAGCTGGG
TTTGTTCATCAGCTTATAACACTGCCCTTTTAATCAATAA
TGGATATTTTGGCACTTCACACAGAACAGACGTGTGTTAT
GGGGAGTGTTTGTTCATGTCAAGTTTCAATTGGGTAGTGA
CTGATCTGTTCTTGTCTTTTATTTTTCCTTGTTTGCTGAT
CATCTCTTTATATTTAAGGATCTTCTATGTCGTTCATCAG
CAAGTGAAGGTTATAAACTCTCTGATGAAGGGTGGTAAAT
GTGTAACGGAGGGTTTAGTGAAGAGGAAATCTGAGAGTAA
AGCTGCTCTGACTCTAGGAATCATTGTGTTAGTTTATCTG
CTTTGCTATATTCCATATTTCATCTGCTCTATAACTGTAA
ACTCCTCCACAACTATAAATGGTTTATTATTTGCTGTATG
TGCCAACTCAGGTCTGAATCCTCTGATTTATGCTTTATTT
TACCCCTGGTTTAAGAAGACAGCTAAACTCATTTTAACCC
TGAAAATTTTTCATTCTGCATCTTCTCTGATCAATATTTT
TACAGAACATTAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations