Transcript

cox8a-201

ID
ZDB-TSCRIPT-091110-1008
Name
cox8a-201
Previous Names
  • cox8a-001
  • dkey-184p9.11-009
  • dkey-270m17.2-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000043560 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000043560|OTTDARG00000031294|ZDB-GENE-030131-9136 cox8a|OTTDARP00000034536 DKEY-270M17.2-001 LG_ CR749775.6 Danio rerio protein_coding NOVEL, 599 bp
AACAAGCTGACGTTTCCCATGAGCGCTCGCTGCACCCTTG
CAGCAGATTCCGGTATCACTTTCCTCTTCCTGGTCATCAT
TATATACTCGATTTGAGAGCAGCAAGATGTCTGGACTTCT
GAGGGGACTAGCTCGCGTCCGCGCCGCTCCGGTTCTGCGG
GGATCCACGATCACCCAGCGAGCCAACCTCGTTACGCGAC
CCGCGAAGGAGGCGCTGGGGCCCGTTGAGACAACAGCCGC
TCTGGCCATATTCACTCTGGCCATCCTGGGACCAGCCGGA
TGGGTTCTATCCAACCTGGAGAACTACAAGAAGAGGGACT
CGGTCGAGTCTGAGTGATCCATCTGTCATGGACTGAAAGC
AGTTTGTCCGGTTTTATCGCTTTTAACATGTCGGGACCAC
CATCGCACAGATTTACCTGCACAACTTCTCTTCTTTGAGG
CACCCAGCTACCTCTCCATTCCTCCAGACACTCCGGTCTT
CTTTACGCTGAGCTGTTTGCTCCTTGTTGTCAACTGTTTA
ATAACATAGAATAATGGGTGTGTCAATTCTCTCAACCTGA
AGCTGTTACATCTGAAATAAACCATTATTTAAATCTTAC

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations