Transcript

ppp4r4-202

ID
ZDB-TSCRIPT-090929-996
Name
ppp4r4-202
Previous Names
  • ppp4r4-001
  • si:dkey-85n7.3-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000007575 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000007575|OTTDARG00000005598|ZDB-GENE-041001-164 ppp4r4|OTTDARP00000006719 ppp4r4-001 LG_ BX255913.8 Danio rerio protein_coding NOVEL, 3304 bp
CAATTCTGAACACCACGCAAATAAATTAGTGATAGATCAA
GCTTTGCAACCAGTGGGACGCGTTTGTCGTGGGAGGACCA
TCCTCTCTTCATCAAAGGCATCACATCAGTCATTATCTGT
CAAGGAGCCACAATAATGACAGCACTTTGACATCCGCGTC
TGGCACATTGGCGAAAACACTTAGGACAGATGTTTGTCAG
GAAAATGACGCCGAGTCAGTCCAGTCTGTTTGGAGAGATT
GATGACCTGCAGGACCTTACTTTCATCGAGAGACCCATAC
GCAGGAGCCTGAAGACTGCAGAAGAGATTGACAAGCTCAC
TGTGGATGAAGATCTCAATGACATAGAGCGAGCAGTCTAC
CTTCTCAGTTCTGGTGAGGATATCCAGCGGGCCAGTGTGA
TCATCAACCTGCCAATCCTGGTGCGTCAGAACCCAGCAGA
GACCTTCCGCAGGGTGGTGCCAAAAGTCAGGGTAGGAGCT
CCTCTTCTACCCCAACAGGAAGTGCTCCATGTAGCTGGAG
CAGATATGCAGCTTGCCGCAGCAGGATCTTTTCTCACCAT
TCTACAAGACGACATTGTCCTCATCCAGACACACACCCAC
TCAATTTTGCAGATAGTTCTTCTAAATCTTGACCACAGGG
ACACAGTGGTCAGCAGTGCTTGGTTGGAGACATTGCTATC
AGCAATCGATGCTTTACCTAAGGAAACTATTAGACAAGAG
ATTCTGAGTCCTCTGTTATCAAAGCATCAGCTCTCTCAGT
CTATTCCGGCACGTCTGGCCAGCTGTCGCATCTTAGGAAA
GGTTGTTGGCAAGTTCGAGTCATCGATAGTGAAGAAGGAC
CTTTTGCCACTAATCAGGTCGTTGTGTCAGGACGTAGAGT
ACGAGGTGCGCGCCTGCATGTGCCGCCAGCTGGAGAACAT
CACCAGGGGAATTGGGCTGGACCACACGAAGGGTGAAGTG
CTCCCAGAACTGGTTGAACTGGCTCAAGATGAAGCCAGTA
CTGTAAGATTGGCAGCTTTCGACACAATAATCAACCTCTT
AGAGATGTTTGATAGTGATGACAGGACTTGTGTCATATTT
CCCTTGGTGAAGGCATTCTGTGAAAAATGCTTTAAAGGGG
ATGAGGCGGTTCTGGCCTCCCTGTCCTTTCAGTATGGAAA
GCTTTGTCATGGACTTTCAGAGTCTTTTACTGACGAGCAG
CACCTCTGGTTTCTGGAGTTTTATAAGAAGCTGTGCTGTC
TGGGTCTGCAGCATGAAAACGGGCATTGCGAAAGCCAGCC
TTACCCGCTGGAACTGGAGAACAAATACGCCCTAGTGCGC
AGGAACTGTGCCTACAACTTTCCTGCCATAGTGTTATTTG
CCGATCCCAACCACTTCCTATCTGAATTATATCGTACCTT
CTCAAGTCTCTGCCATGATCCTGAGATTTCAGTAAGAAGG
ACAGCAGCTGGTGGTTTCCATGAGGTGGTCAAATTACTGG
GCCCAAATGTGCATTACATACACAAAGAACTAATCACTTT
GCTGCAGGATGATTCATTAGAGGTACTGGATGCTCTGCTG
AACAATCTTCAGGAGACTTTAGAGCTGGCCACGTCTAGAG
GAGAGGGAGCAGGACCTGAAAGCAAGCAGGTGAATATACA
AGACTTGGTGCCAGCTTTGGTAGCAGCAGAGCAGAAAGCG
GCTTCTTCCCTTCACTGGCGAGTTCATGAAAAGCTGCTTC
AGTGCTACTCGTGTCTGCCTCGTGTCATTTCTGGAGACCA
AATCTACTTCCGCTTCTTTCAGAGGATGTTCAGCATCATC
ACCACTAATAATGTTCTGCCAGTCCAGCGGGAAGCTGTCA
GGACGTTATGTGTGTTCCTGCGCTATAACCGCAAACAAGA
ACAGCGGCAAGAGATAATGAGTAAAATAAAACAAGATCTT
GCTCAAGGTAGAAGCTACTGGAACAGGCTTCGCTTTTTGG
ACCTGTGTGATATCACAATAGACCTCTTCTCCAAATCATA
TTTTTGCAAACATTTTCTTATTCCAGCACTTGAGTTAGTT
AGTGATCCTGTGGCCAATGTCAGGTACAAGCTCTGTTATA
TGTTGCCCAAATTGAGATCCACCATCAGACCAACAGAAAA
GCATCTGCTTCAGCAGCTGGAGTTCTGTGTTCGGAAATTG
TTGTGCCGTGAAAAGGATAAAGATGTAGTGGTGACATTGA
GAAAGACAGTTCTGGAGCTGGACAAAATGGACATTACAGA
GCCGTATCATAAAAGGCATGAAAGAGAGCTCTTGGATCAG
AAAAAGGAGAAGGAGGAGACCCTTTTACTTGAAATGGAAC
TGTTGGAAAGACAGCAGAGTGAAGCAAAACTAGCTGGAGA
TAAACAGTCTGAGAAGAAACAACGAGAGAGCAAATCAGGC
CTATCTGGTAGTAAAGGAATGTCAGGAACATTATCAGGAG
CATCATCGTCCTCTTCTTCTGGGAAGGAGATGCGGAGGGC
TAAACTAGCTCGCAGTCGTTCTCTCAGTGGCCATCCCACA
ACACCCAAGATGACAAACTCAGACAAAACCTTAAAACTGA
AAGATTCAGGAAGTTGCCCTGGATCAGGAAAGAGTCCTAT
GCTACCTTTAAATGATGATAACCTGCGACCCCACCACTTT
AATGTTGCTTCTTCAATCTCCTCCACCCCATCGTCCTCGT
CCATGCCTGTTCTGATCCGCAGCAACACCAGCAGCTCTGT
GGATCACCGGAGTAACGGGAATAAAGACACACAGTCTAGG
AAACTTTCTGTACAGCGGAAGTCGAATTCATTTGGAATGC
AGTCTGGGAGAGAGTGATTACCACTTTGCCTTCTGACTTA
AAGCCCCTTTTACAAGACTTTTCATTCTGCAGCAGCAGCA
CAGCAGTGTCCCTCCATTTTGATGTGTCCATTCTCTCTTC
TATCCCAGAAAAGGCTTAAGATGTGCTGGGGCATCAATTA
AGGTCTGCATTGATCCATCTCTGCCTTATTTCATACAAAA
AAAACAATCAAAATCTCACACCATACATCATAAAATGAAA
CCGAGAGTTGAGGAGTAATTGAATGTATTTAATTTACTGC
CTCATTATTTTGTTTCTTGTATTATAGCATGCTTTGCAAA
ATTCTCTGTTTTATATTTTTGAAGTGGCTAAGAGAAAAAG
AAGCACTATGTATTTTTATGATTGAAGAGTTTTGGAACTC
TCCATCCCATCCCACCAATGAGATTGTGCCTGGTGCCACC
CAGCACCTGATTGATTAACGCCAACATCTTAGTACCCAAT
GAATAAAATTCATGTTGAATATGA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations