ZFIN ID: ZDB-TSCRIPT-090929-996
Transcript Name: ppp4r4-202
Previous Names: ppp4r4-001, si:dkey-85n7.3-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000007575 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000007575|OTTDARG00000005598|ZDB-GENE-041001-164 ppp4r4|OTTDARP00000006719 ppp4r4-001 LG_ BX255913.8 Danio rerio protein_coding NOVEL, 3304 bp
CAATTCTGAACACCACGCAAATAAATTAGTGATAGATCAA
GCTTTGCAACCAGTGGGACGCGTTTGTCGTGGGAGGACCA
TCCTCTCTTCATCAAAGGCATCACATCAGTCATTATCTGT
CAAGGAGCCACAATAATGACAGCACTTTGACATCCGCGTC
TGGCACATTGGCGAAAACACTTAGGACAGATGTTTGTCAG
GAAAATGACGCCGAGTCAGTCCAGTCTGTTTGGAGAGATT
GATGACCTGCAGGACCTTACTTTCATCGAGAGACCCATAC
GCAGGAGCCTGAAGACTGCAGAAGAGATTGACAAGCTCAC
TGTGGATGAAGATCTCAATGACATAGAGCGAGCAGTCTAC
CTTCTCAGTTCTGGTGAGGATATCCAGCGGGCCAGTGTGA
TCATCAACCTGCCAATCCTGGTGCGTCAGAACCCAGCAGA
GACCTTCCGCAGGGTGGTGCCAAAAGTCAGGGTAGGAGCT
CCTCTTCTACCCCAACAGGAAGTGCTCCATGTAGCTGGAG
CAGATATGCAGCTTGCCGCAGCAGGATCTTTTCTCACCAT
TCTACAAGACGACATTGTCCTCATCCAGACACACACCCAC
TCAATTTTGCAGATAGTTCTTCTAAATCTTGACCACAGGG
ACACAGTGGTCAGCAGTGCTTGGTTGGAGACATTGCTATC
AGCAATCGATGCTTTACCTAAGGAAACTATTAGACAAGAG
ATTCTGAGTCCTCTGTTATCAAAGCATCAGCTCTCTCAGT
CTATTCCGGCACGTCTGGCCAGCTGTCGCATCTTAGGAAA
GGTTGTTGGCAAGTTCGAGTCATCGATAGTGAAGAAGGAC
CTTTTGCCACTAATCAGGTCGTTGTGTCAGGACGTAGAGT
ACGAGGTGCGCGCCTGCATGTGCCGCCAGCTGGAGAACAT
CACCAGGGGAATTGGGCTGGACCACACGAAGGGTGAAGTG
CTCCCAGAACTGGTTGAACTGGCTCAAGATGAAGCCAGTA
CTGTAAGATTGGCAGCTTTCGACACAATAATCAACCTCTT
AGAGATGTTTGATAGTGATGACAGGACTTGTGTCATATTT
CCCTTGGTGAAGGCATTCTGTGAAAAATGCTTTAAAGGGG
ATGAGGCGGTTCTGGCCTCCCTGTCCTTTCAGTATGGAAA
GCTTTGTCATGGACTTTCAGAGTCTTTTACTGACGAGCAG
CACCTCTGGTTTCTGGAGTTTTATAAGAAGCTGTGCTGTC
TGGGTCTGCAGCATGAAAACGGGCATTGCGAAAGCCAGCC
TTACCCGCTGGAACTGGAGAACAAATACGCCCTAGTGCGC
AGGAACTGTGCCTACAACTTTCCTGCCATAGTGTTATTTG
CCGATCCCAACCACTTCCTATCTGAATTATATCGTACCTT
CTCAAGTCTCTGCCATGATCCTGAGATTTCAGTAAGAAGG
ACAGCAGCTGGTGGTTTCCATGAGGTGGTCAAATTACTGG
GCCCAAATGTGCATTACATACACAAAGAACTAATCACTTT
GCTGCAGGATGATTCATTAGAGGTACTGGATGCTCTGCTG
AACAATCTTCAGGAGACTTTAGAGCTGGCCACGTCTAGAG
GAGAGGGAGCAGGACCTGAAAGCAAGCAGGTGAATATACA
AGACTTGGTGCCAGCTTTGGTAGCAGCAGAGCAGAAAGCG
GCTTCTTCCCTTCACTGGCGAGTTCATGAAAAGCTGCTTC
AGTGCTACTCGTGTCTGCCTCGTGTCATTTCTGGAGACCA
AATCTACTTCCGCTTCTTTCAGAGGATGTTCAGCATCATC
ACCACTAATAATGTTCTGCCAGTCCAGCGGGAAGCTGTCA
GGACGTTATGTGTGTTCCTGCGCTATAACCGCAAACAAGA
ACAGCGGCAAGAGATAATGAGTAAAATAAAACAAGATCTT
GCTCAAGGTAGAAGCTACTGGAACAGGCTTCGCTTTTTGG
ACCTGTGTGATATCACAATAGACCTCTTCTCCAAATCATA
TTTTTGCAAACATTTTCTTATTCCAGCACTTGAGTTAGTT
AGTGATCCTGTGGCCAATGTCAGGTACAAGCTCTGTTATA
TGTTGCCCAAATTGAGATCCACCATCAGACCAACAGAAAA
GCATCTGCTTCAGCAGCTGGAGTTCTGTGTTCGGAAATTG
TTGTGCCGTGAAAAGGATAAAGATGTAGTGGTGACATTGA
GAAAGACAGTTCTGGAGCTGGACAAAATGGACATTACAGA
GCCGTATCATAAAAGGCATGAAAGAGAGCTCTTGGATCAG
AAAAAGGAGAAGGAGGAGACCCTTTTACTTGAAATGGAAC
TGTTGGAAAGACAGCAGAGTGAAGCAAAACTAGCTGGAGA
TAAACAGTCTGAGAAGAAACAACGAGAGAGCAAATCAGGC
CTATCTGGTAGTAAAGGAATGTCAGGAACATTATCAGGAG
CATCATCGTCCTCTTCTTCTGGGAAGGAGATGCGGAGGGC
TAAACTAGCTCGCAGTCGTTCTCTCAGTGGCCATCCCACA
ACACCCAAGATGACAAACTCAGACAAAACCTTAAAACTGA
AAGATTCAGGAAGTTGCCCTGGATCAGGAAAGAGTCCTAT
GCTACCTTTAAATGATGATAACCTGCGACCCCACCACTTT
AATGTTGCTTCTTCAATCTCCTCCACCCCATCGTCCTCGT
CCATGCCTGTTCTGATCCGCAGCAACACCAGCAGCTCTGT
GGATCACCGGAGTAACGGGAATAAAGACACACAGTCTAGG
AAACTTTCTGTACAGCGGAAGTCGAATTCATTTGGAATGC
AGTCTGGGAGAGAGTGATTACCACTTTGCCTTCTGACTTA
AAGCCCCTTTTACAAGACTTTTCATTCTGCAGCAGCAGCA
CAGCAGTGTCCCTCCATTTTGATGTGTCCATTCTCTCTTC
TATCCCAGAAAAGGCTTAAGATGTGCTGGGGCATCAATTA
AGGTCTGCATTGATCCATCTCTGCCTTATTTCATACAAAA
AAAACAATCAAAATCTCACACCATACATCATAAAATGAAA
CCGAGAGTTGAGGAGTAATTGAATGTATTTAATTTACTGC
CTCATTATTTTGTTTCTTGTATTATAGCATGCTTTGCAAA
ATTCTCTGTTTTATATTTTTGAAGTGGCTAAGAGAAAAAG
AAGCACTATGTATTTTTATGATTGAAGAGTTTTGGAACTC
TCCATCCCATCCCACCAATGAGATTGTGCCTGGTGCCACC
CAGCACCTGATTGATTAACGCCAACATCTTAGTACCCAAT
GAATAAAATTCATGTTGAATATGA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
ppp4r4-202 Contained in:
OTHER ppp4r4-202 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000007575 (1)
  • Ensembl_Trans:ENSDART00000141486 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:EB959596 (1) 671bp
    GenBank:EB915740 (1) 660bp
    GenBank:EB928728 (1) 628bp
    GenBank:BQ449904 (1) 603bp
    GenBank:BQ450110 (1) 597bp
    GenBank:BQ419857 (1) 576bp
    GenBank:EE210352 (1) 566bp
    CITATIONS (2)