ZFIN ID: ZDB-TSCRIPT-090929-9905
Transcript Name: agfg1b-202
Previous Names: agfg1b-002, zgc:66055-002

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000027343 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000027343|OTTDARG00000021473|ZDB-GENE-040426-1520 agfg1b|OTTDARP00000022394 agfg1b-002 LG_ CR377211.7 Danio rerio protein_coding KNOWN, 846 bp
GAGCCAAAGCAGCTGAACTTCATTCTAATGTTCACGGAGG
AAAGCGTGGCGTTCGTGCTTCATGGCTGGATGTGAGATTG
TGTTCAAAAAACGAGGCCTCAACCCTCCACACAGAGTGAA
GTCCATCTCTATGACAACTTTCACCCAACAGGAAATTGAG
TTCTTGCAAAAACACAGCAATGAGCTCTGCAAACACATTT
GGCTGGGGCTGTACGATGACAAGAGCTCTGTGATCCCAGA
TTTCCGCGAACCTCAAAAAGTCAAAGAGTTTCTTCAGGAG
AAATATGAGAAGAAAAGATGGTATGTTCCCCCAGAACAAG
CCAAGGTTTTAGCCTCAGTGCAGGCCTCGATATCTGGTTC
ATCAGCTAGCAGCACCAGCAGCACCCCAGAGGTTCTTCCA
CAGCCCCTCAAAACCCTGCATCTCACCAAGACTCCTTCTA
ACCAGTCCCCAGTGATCAGTCGTGCTCAGTCTGTAGGCCA
GGAGAAAAAGTTTGACCTCCTCTCAGACTTGGGTGGAGAT
ATTTTTGCTGCCCCTCAAGCTCAAACTGCCGGCTCTTCAA
ACTTTGCAAATTTTGCACATTTTAACAGGCCCTCAGCACA
AAATAATTCCACCACAGACTTTGCCAACTTTAATTCCTTT
GGAAACGCCAGTGTATCATCACATTTTGGCACATCACCCC
CCTCAAAGCCTTCCCTCCAACAGCCCCACACAGGAGGAGG
CATGTCCGTTCCTCCACTACCCAGTATGCCTCCTGCACCA
CCTCTGGCTGGTTTATCAAGAGAGGACCGTTATGCTGCGC
TGGCTGAGCTTGACAGTGCCCTCAGTATTACCATCCCCGC
ACAAGG

agfg1b TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA agfg1b-201 (1)    Ensembl 2340
agfg1b-202 846
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
agfg1b-202 Contained in:
[BAC] DKEYP-13A3 (1)

Genome Resources: Vega_Trans:OTTDART00000027343 (1),  Ensembl_Trans:ENSDART00000146855 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:EG580705 (1) 950 nt
CITATIONS (2)