Transcript

si:dkey-241l7.4-201

ID
ZDB-TSCRIPT-090929-987
Name
si:dkey-241l7.4-201
Previous Names
  • si:dkey-241l7.4-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000007553 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000007553|OTTDARG00000006777|ZDB-GENE-041014-238 si:dkey-241l7.4|OTTDARP00000006699 DKEY-241L7.4-001 LG_ CR381646.8 Danio rerio protein_coding KNOWN, 809 bp
TTAGTCTACTTGTTCACCATCATGGCCACCAATCCAGCAG
CGTGTGCAGTGTTCCAGTTGCTGTCAGTAATTTCCTTCAG
CTGTGTTGATCTTCAGCTCAATCTGTATCACCTGTATGAG
TTGATCAGTGAGTGTATTTGACAGCAGGGCTGATTCAGCC
ATTTCACACACTCTTCATCTGAAGCTTCACTGAAGGTGAT
CATCTGCAGACCAAGGTTCATGATGTTCCTGCTGAGGAGT
CTTCTGCTGCTTTCTATCGTGTTCTCCATGGAGGGTGCAG
ATGAGGAGCGACTTCGCTGTGAAAGAGGCTGGAGCGGGTC
TGGCTCTCGCTGCTTCAGGTTTTTCTCCAGGTCTGTGAAC
TGGGTCACAGCAGAGAGAAACTGTCAGAGTCTTGGAGGGA
ATCTGGCTTCTGTGCATGATCAAGTGGAGAATGACTTTCT
GCTGAGTCTGGTGCCGGGCTCCACACGCTGCTGGATTGGA
GGCCATGATGGTGAACAAGATGGACAGTGGTTGTGGTCTG
ATGGATCTGTTTATGGTTACACCAACTGGTGCTCAGGAGA
GCCTAGTGGTGGGTCTGAACACTGCTTGGAGATCAACTGG
ACATCGAACCGTTGCTGGAATGATCAGCGCTGTTCAACCC
GAATGGGCTATCTGTGTGCTAAACGGCGTGTACCGTGTTA
GTGTGACTGTAACTTCACCCGAGTCTTCACTCTGTTTCTC
ACATCAAACCAATAAAAGTGAAGTAAATGGTGACTGCTGT
GGTGAATCTGTCAGTTTTTTTTTTTTTATAAAGATTTGAG
GGGTTGTGG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations