ZFIN ID: ZDB-TSCRIPT-090929-9867
Transcript Name: mrpl30-201
Previous Names: mrpl30-001, zgc:112089-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000027303 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000027303|OTTDARG00000021453|ZDB-GENE-050522-240 mrpl30|OTTDARP00000022364 DKEY-57A22.5-001 LG_ CR536604.6 Danio rerio protein_coding KNOWN, 814 bp
TATTTTGAAATCAGTCTTTTTACCAAACGGTGTCGTTTCC
TTTTCCTAGCAACACATTTGACATACATGTATGGGCTGTA
GTTTATTTAGATGTGGTGATACGTTTATTGATTACCATAT
CACAAGAACGTGGCTATGAAAGTCAGTTGCATTAAATTCC
TTGATGCATTTGCGGTCATTGTGTAGTTTACTCAGAGTAT
TATACTGGGCATGAGTAAGTCATTCTAGCTAGCTTGCTAG
CTAATAACCTTCCAAGGCAGCAGCATCAAACAGTCGTGTA
ACGATGGCAGGACTGTATCGAGCTCTTCTGACATCTGCCT
CCAATGTTTCAAAGAATTTGACACAAGTCTCTCCATGTCG
AACTAAATTCACGAAGAGTCGCATCTCTCCACAGGTGTTT
GAGGAGCGAGCCAAAGAGCATGACAAGTATGGGGGAGACC
CAGAGCAGCCACATAAACTGCATATAGTGACACGGGTGAA
GAGCACGATGAGACGGCCATACTGGGAAAAGAAAGTGGTG
AAGAGTTTGGGGCTCATGAAGTCACATGAGCCCCGTGTCC
ACAAGAACACCCCCTCAGTGAACAATCTACTCAAAATCAT
CAAGCATCTGGTTAGGATTGAGCCACTCAAGCTTCCTCAT
GGATTACCGGCTGAAGAAGACATGGCCAACACACATCTGA
ACAGCAGAGGAGAGCTGGTGGTCAAACGTCTCCTCAAACC
ACTGGAGAAAAAGGCCATTGAGTCATAGAACATTGATCTG
ACCTACTGTCTGCATGTGTATCTTTCTACTTGTTTAATAA
AGATTAAAAAAAAA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
mrpl30-201 Contained in:
[BAC] DKEY-57A22 (1) (order this)

Genome Resources: Vega_Trans:OTTDART00000027303 (1),  Ensembl_Trans:ENSDART00000101986 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:BC095668 (1) 796 nt
GenBank:EB846469 (1) 382 nt
CITATIONS (2)