ZFIN ID: ZDB-TSCRIPT-090929-9692
Transcript Name: anxa13-201
Previous Name: anxa13-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000027112 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000027112|OTTDARG00000021345|ZDB-GENE-010406-1 anxa13|OTTDARP00000022218 anxa13-001 LG_ CR352329.9 Danio rerio protein_coding KNOWN, 3639 bp
GTCACTTACAGAAACTATTGCGTGTGGCCTGCAGTTCGGA
CAGCGGTCAGATCATCAGATCATCAAAAACACCAAACTCT
CATCATGGGAAACTGTCAACCAACAATTGTGCCTTATGAA
GACTTTGATGTAATTGCGGACATTAAGGCAATCCGCAAAG
CCTGCAAAGGTTTCGGAACGGACGAGAAAGCCATCATAGA
CATCCTAGCCTATCGAAGTGCAGCTCAGAGAATGGAGATC
AAGCAAGCCTACTTTGAGAAATATGATGACGAGTTGGTGG
ATGTTCTGAAGAGTGAGCTGTCTGGGAATTTTGAGAATGC
CATTCTTGCCATGTTGGACCCTCCTCACGTGTTTGCAGTT
AAAGAGCTCAGGAAGGCAATGAAGGGCGCAGGAACAGATG
AGGATGTGCTGGTGGAGATTCTGTGCACTGCTACCAATGA
TGAGATTGCCTTTTACAAAGAGACCTACACCCAAGTGCAT
GACAGGGATTTGGAGAGTGACATTGAAGGAGACACCAGTG
GGGATGTGAGGAGACTGCTAACATTGCTTCTCCAGGGTAA
CAGAGACGAGAGCTACGAGGTTGACGAAGCACTGGCGGAG
CAAGATGCCGTTTCGCTGTTTGAAGCTGGAGAGGGCAGTC
TTGGCACAGATGAATCTACTTTCAGTTTCATTCTGGCCAC
CAGGAACTACTTACAACTTCAGGCCACGTTCAAAGCCTAT
GAAGCCATTTCTGGAACAGATATTCTGGATGCAATCGATA
AGGAAACCTCTGGAACTCTGAAGGACTGCTACACCACGCT
TGTGAGGTGTGCTAAGAACCCCCAGCTGTTCTTTGCCCGG
AGGTTGAACGCCGCTATGAAAGGAGCCGGAACCGATGAAG
ACACTCTCATCCGCATCATCGTGTGTCGCTCAGAGGTTGA
TCTGGAGACTATTAAAGACATGTACCTGGAGAAATACGAC
GTGACTCTGAAAGACGCCATCAGCTCTGAATGCGGAGGCG
ATTTCAAGCGCCTCCTGCTGGCCATCCTTCACTGAGAACA
ACATTCAGCCACTGGCGCTCCAGGCTTTAACTATAGTCAC
CATCAAGGCAAACTAACAAGACTTATTTTCTGTCATGTAG
TCTACAAACATGTTTTTATATATATAAAGGACAGTTTAAA
GTAAAGAAATCAAGTTTTATTACACCGTACAACTATATAT
TCCAGTATATATTAAAGGGATAGTTCACTCAAAAATGAAA
TTTTGCATATCATTTACTTTCAATTTCTATGAAGTTATTT
TAAAGAAAGCTGAAAACATGTAACCACTGACTTCCATTAT
AGGAAATATAAACACTATGGAAGTTAATGGTTGCAGGTTT
CCAACATATTTCGAAATATCTTTAGTGTTCAACAGAAGAA
AGAAGCTCATAAAGGTTTAAAACAAGTAAATGCTAAGTAA
TAGCAGATTTAATTTTTTTTATGTGAACTATCCCTTTAAG
AATCACCACTAAAAATATATATGATTCCAAGCAGAGATAT
GCATTTGTGTTGGGTTTCTGTGACATTCTGTGTCAAGACT
GGCCAGTTAAACGTAAGTAGAGTCTTTACAGGATTACAAG
ATAACATTGTTAGACTATGATAATAACAGGTTGAGAAGCA
GTGGCGTACATTTCCTGCCAGTATTTTTCCATACCAAAAA
CCTCACAGTTTTAAATTGCACGTGACAATGTGAATTCTGA
AAATGTGCTTAAGTATAAAAAGAAATGTTAAAATAACAAT
CTGACATGATCAGCGAAACAATCATCTGTTTATGAGACGT
CTGCAGCTAATGTGTCGCATCTGTGGTAAAATATCTGCAT
CAGTGAAGTGATCATTTTTAATAACGTTAACACGAGACTA
AAGTATTTATGTTATTTAGATGAGATTTTTTTAATATAAC
TTACATTATGTTTTAAAGTATCTGAAACACAAGAATTCAG
ACAGAGTTGTGCTGTTCTCCCCCCTCAAATAAAAGCCTAT
TTTATCAGATTAATATAAAAACATTCACTATACAGGAGAT
TGGACTCATATCTTCTGTTTTAACACAGTTGTATCCATTG
AATAAAATAAAAGATTTTAAAGTATGTTGATTTGTCTTGC
ACATTTAATGAGGCACTGGCATTAATATAGTAATTATTGT
GTATTATTTTTTTAATCAACGTTAAACTGCATAACAGGAT
CTTAAATCACTGTCCAAGCAAAGTCATGTTGTTTCTGTTA
CTTACCTCTTCTCTAGTCAAGCAGGCCTAATCACAGTCAC
CTTTAATTAGTTGATTACTTGACTTTATTATTATTATTTT
CTAGTTTATAACATTCAGCATGTACTAAAGGATGAAAAAC
TGTCAAATAATCAAGCAATAACTTAAAATCTAAATGTGGA
CAGGAAGCCAAATCTAACGATACTAGACAATACTAACCCT
AACCACCCTTCCAGTCAAATATTGCACAGTAATGTTTGTG
TTGGGAAATGACCATAGTAAAAGTGGGTTGTGTGCATTGT
GTGTGACATTGCATCGTTGAGTGATGCAATCTCAGCTTGC
ATCATAAAGATACTATTGTTTAACTCTGGCAATTTTGCAT
TGCATTTTATCATTGTAAATTATGGAAAGTTTGAATCATT
TTACCGACTCTGAGTCTCATTTAGCGAGATAATTTCATTT
CGTTCAATTTGCCAAAATGTCTTTAAAATGTTGCTTCTTG
AACACATCTACAACTAGCGCAAATGATAATCACACAATAC
TACGAACATAAATGCTGCAAGATAAAGAAAATAAGATGTC
TTTGCTTACCTGGGTCTTTAGTTCGCTTATCTGAAGCCTT
CAAGTTGATTCATTCATTCATTCACATGACACTGACAGCA
ATAAGCTTAACCAATAAATATCGAAAAAAGATCCATGATT
ATTATTATAAATAAAATTAATTCCAGTTAATATTAAAAGA
TTCTACAAAGATCACAGTCAAGCTATATCAGTTTTTAATC
ATTTTAGATTTAATTTTGTATGATCACTTGAATATAATGA
TTAGGGGGGTGGCATGGTGGTTCAGTGGTTAGCAAGAAGG
TCACTTGTTCAGCTCCAGGCTAGGCCAGTTGGCATTTCTG
TGTGGAGTTTGCATGTTGGCATGGGTTTCCTCCAGGTGCT
CCAATTTCCCTTACAGTCCACAGTCAAAATTGGAAAAATT
TGGCTATAATTTATGAGTGTTTCCCAGTCCTAGCTTGTGA
CTAGAAGGGCACTGCGTCAAACATGTGCCAGAATAGTTGG
TGGTTCATTCCGCTGTGGTGACCCTTGATAAATAAGAGAC
TAAGCCGAAGGAAAATTAATAAATGAACAACGATTAAGTA
TTTGGTACATTTTTTTTAATGCTGAATGACAATTGAAGAT
TATTTCACCCATATTTTATCATTTTAAAAGTTATATATAA
CATTAAAGAAGACACTTCACTTGGATTCGGTGGTTTCCAT
GTATATCAAACCACTTTTGTGAATGTAGTTTAATGCCAAA
ATGTGACATCTTGTCCCTCATATTACTGAAAAATGTGCTT
ACTGGATGCTGCGACTGACCAACTAGATCTCTTTACAAGT
TTCCAAAGGGTCTTATAATTAATAAACATTTATTAAACA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
anxa13-201 Contained in:
[BAC] CH211-196F6 (1)

Genome Resources: Vega_Trans:OTTDART00000027112 (1),  Ensembl_Trans:ENSDART00000013294 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:BC056562 (1) 2043 nt
GenBank:AJ306452 (1) 1136 nt
GenBank:AY178803 (1) 1102 nt
GenBank:CT636573 (1) 657 nt
GenBank:CK690307 (1) 322 nt
CITATIONS (2)