Transcript

sfxn1-201

ID
ZDB-TSCRIPT-090929-9677
Name
sfxn1-201
Previous Names
  • sfxn1-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNACentral
Note
None
Sequence
OTTDART00000027095 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000027095|OTTDARG00000021334|ZDB-GENE-040801-45 sfxn1|OTTDARP00000022207 sfxn1-001 LG_none CR855307.18,CU657979.7 Danio rerio protein_coding KNOWN, 1730 bp
AGTGCGCGAGTCTGATCTGATCTCCGCTGCTGTGATTCCC
TGACGCCGAGATTTGCACTGTTGCACTTGTGCCATGGCAG
CGACGATCTCCACCTCCATAAACATTAAAGAGCCGCGCTG
GGATCAGGGAACATTCGTGGGTCGAGCCAAGCATTTCTTC
ACCGTCACAGACCCCAGAAACATCCTGCTGTCCAACAAAC
AACTAGAAAAAGCACATCAGATTATTCAGGATTACAAGAA
AGGCGTGGTAGCAGCAGATCTCACAGAGGATGAATTATGG
AGGGCGAAATATGTTTTTGACTCCGCCTTCCATCCAGACA
CAGGAGAGAAAATGCTGCTGATTGGTCGCATGTCAGCTCA
GGTGCCCATGAACATGACCATCACTGGATGCATGATGACC
TTCTACAGAACGACTCCAGCGGTTCTGTTTTGGCAGTGGA
TCAATCAGTCCTTCAATGCAATAGTCAACTACACCAACAG
GAGCGGAGACGCACCAATCACAGTCAACCAGCTTGGGACA
GCGTATGTATCAGCCACCACTGGCGCAGTGGCTACCGCTT
TAGGACTGAATGCACTAGCAAAGCATGTGTCTCCACTCAT
AGGACGCTTCGTCCCGTTCGCTGCTGTCGCTGCTGCTAAC
TGTATTAATATTCCACTCATGAGACAACGGGAACTCAAAC
ATGGTATTCCAGTAACGGATGAGAATGACAATCGATTAGG
AGAATCTTCAAAGGCAGCTCAACAGGCCATCACACAAGTG
GTGGTGTCCCGAATCCTCATGGCTTCTCCGGGAATGGCCA
TTCCTCCATTTTTAATGAACTCTTTGGAAAAGAAAGCTTT
CCTGAAGAGGTTTCCATGGATGAGTGCACCCATTCAAGTT
GGCTTGGTTGGGTTTTGCCTGGTGTTCGCAACCCCGCTGT
GCTGTGCGTTATTCCCACAAAAGAGCTCTATGGCAGTGAG
CCGCCTGGAGCCGGAGTTGCAAGAGAAGATTCGAGCCAGT
CATCCTGGAGTAGAGACGGTTTATTTCAACAAAGGACTGT
AGAAACAAACCCCGGTGAACCTGCTTACTGCTGTAAAAGT
TTCACGTACCATCTAAAAACATCTCTTTGTGTGCCAAAGT
TCACCCGTTCCTCTCCAGGACATCCCGACTCAGTCATTTT
GTAAGAGATTTTTTTAATTTTATTTCCGTTTTAATTGTTT
TTAAGCTGATTATTGTTGTTGCCGATCTGTGTCTTTTGTC
TGACGTGTATGACGGTGCTCTCTGCTGTTTATATGTACAC
GCTCTAGAAAATGCTGGGTTGCTGTAACTCTTGATACCTT
TTAGAAATATTAACCATCTCTGATACCGTGAGGGGAAAAG
TAATCCCAAAACATTAAGAGCTTACAGTTTTGATTTGATT
CATTTCAAGTAGTATAACCCACTCTTTCAAACGCATTTGG
AAACACAAATGGATTTCATCATAATCAATAAAACATCTTC
ATATCTGTGTAAACTCACAAATAACTATTGATTTTAATTA
GTTGGAAATGGAGCAGGATGAAGCACAAGGTTATCCGCTT
GTTAAGTCATGACATGAAATACTGTTTCCGGCTCCAAGCT
GCTACTCATTTTGATATTCGTTTATGACCACTTTTTAGAC
ATATCACACATTAAAGTGAATTTTATATAAAATCATGAAG
TACACAACAGTCTTTGGACTTCTGCATTACAGGCACCAAT
ATTTTAACAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations