ZFIN ID: ZDB-TSCRIPT-090929-9677
Transcript Name: sfxn1-201
Previous Name: sfxn1-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000027095 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000027095|OTTDARG00000021334|ZDB-GENE-040801-45 sfxn1|OTTDARP00000022207 sfxn1-001 LG_none CR855307.18,CU657979.7 Danio rerio protein_coding KNOWN, 1730 bp
AGTGCGCGAGTCTGATCTGATCTCCGCTGCTGTGATTCCC
TGACGCCGAGATTTGCACTGTTGCACTTGTGCCATGGCAG
CGACGATCTCCACCTCCATAAACATTAAAGAGCCGCGCTG
GGATCAGGGAACATTCGTGGGTCGAGCCAAGCATTTCTTC
ACCGTCACAGACCCCAGAAACATCCTGCTGTCCAACAAAC
AACTAGAAAAAGCACATCAGATTATTCAGGATTACAAGAA
AGGCGTGGTAGCAGCAGATCTCACAGAGGATGAATTATGG
AGGGCGAAATATGTTTTTGACTCCGCCTTCCATCCAGACA
CAGGAGAGAAAATGCTGCTGATTGGTCGCATGTCAGCTCA
GGTGCCCATGAACATGACCATCACTGGATGCATGATGACC
TTCTACAGAACGACTCCAGCGGTTCTGTTTTGGCAGTGGA
TCAATCAGTCCTTCAATGCAATAGTCAACTACACCAACAG
GAGCGGAGACGCACCAATCACAGTCAACCAGCTTGGGACA
GCGTATGTATCAGCCACCACTGGCGCAGTGGCTACCGCTT
TAGGACTGAATGCACTAGCAAAGCATGTGTCTCCACTCAT
AGGACGCTTCGTCCCGTTCGCTGCTGTCGCTGCTGCTAAC
TGTATTAATATTCCACTCATGAGACAACGGGAACTCAAAC
ATGGTATTCCAGTAACGGATGAGAATGACAATCGATTAGG
AGAATCTTCAAAGGCAGCTCAACAGGCCATCACACAAGTG
GTGGTGTCCCGAATCCTCATGGCTTCTCCGGGAATGGCCA
TTCCTCCATTTTTAATGAACTCTTTGGAAAAGAAAGCTTT
CCTGAAGAGGTTTCCATGGATGAGTGCACCCATTCAAGTT
GGCTTGGTTGGGTTTTGCCTGGTGTTCGCAACCCCGCTGT
GCTGTGCGTTATTCCCACAAAAGAGCTCTATGGCAGTGAG
CCGCCTGGAGCCGGAGTTGCAAGAGAAGATTCGAGCCAGT
CATCCTGGAGTAGAGACGGTTTATTTCAACAAAGGACTGT
AGAAACAAACCCCGGTGAACCTGCTTACTGCTGTAAAAGT
TTCACGTACCATCTAAAAACATCTCTTTGTGTGCCAAAGT
TCACCCGTTCCTCTCCAGGACATCCCGACTCAGTCATTTT
GTAAGAGATTTTTTTAATTTTATTTCCGTTTTAATTGTTT
TTAAGCTGATTATTGTTGTTGCCGATCTGTGTCTTTTGTC
TGACGTGTATGACGGTGCTCTCTGCTGTTTATATGTACAC
GCTCTAGAAAATGCTGGGTTGCTGTAACTCTTGATACCTT
TTAGAAATATTAACCATCTCTGATACCGTGAGGGGAAAAG
TAATCCCAAAACATTAAGAGCTTACAGTTTTGATTTGATT
CATTTCAAGTAGTATAACCCACTCTTTCAAACGCATTTGG
AAACACAAATGGATTTCATCATAATCAATAAAACATCTTC
ATATCTGTGTAAACTCACAAATAACTATTGATTTTAATTA
GTTGGAAATGGAGCAGGATGAAGCACAAGGTTATCCGCTT
GTTAAGTCATGACATGAAATACTGTTTCCGGCTCCAAGCT
GCTACTCATTTTGATATTCGTTTATGACCACTTTTTAGAC
ATATCACACATTAAAGTGAATTTTATATAAAATCATGAAG
TACACAACAGTCTTTGGACTTCTGCATTACAGGCACCAAT
ATTTTAACAA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
sfxn1-201 Contained in:
[BAC] DKEYP-121D2 (1)
[Fosmid] CH1073-353O20 (1) (order this)
OTHER sfxn1-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000027095 (1)
  • Ensembl_Trans:ENSDART00000023654 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BC078297 (1) 1780bp
    GenBank:CK707230 (1) 917bp
    GenBank:EG574065 (1) 877bp
    GenBank:CK678870 (1) 806bp
    GenBank:BI326312 (1) 573bp
    CITATIONS (2)