ZFIN ID: ZDB-TSCRIPT-090929-9667
Transcript Name: apbb1ip-201
Previous Name: apbb1ip-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000027083 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000027083|OTTDARG00000021324|ZDB-GENE-040426-1318 apbb1ip|OTTDARP00000022198 apbb1ip-001 LG_ CR385039.8 Danio rerio protein_coding KNOWN, 3287 bp
AACAGGAAAGAGGCATTTTGCTCAAAACGGATTTATGACC
CCATCACCTACTTATTAAAGCGGCCAGATAACCCAAGATG
GATGACATTGATGCCATGTTCAGCGATATGCTGCAGGAGA
TGGATCTCCTAACGCAGAGTTTGGATGCAGAAGTAGATTC
TGCACCTTTGGCTAAACCTCCCACCATTCCTGAACCTCAG
GAAATGAACTTTTCCATCGGTTTCGCAAATTTTAATGAAT
CCCTGAACGATCTGGAAGACAATGACTTAGACGCCTTGAT
GGCTGACCTTGTGGCAGATATAAGTGCCACGGAGGAAAAG
TTTGCCACAGAAAGAGACACATCAAAGGGGTCAGTTTCAG
TTGCCCCAGCGCCCTCAAAGCCTCAGAGTAACTTTAGCCT
CCCAGCATCATTCGACAGCTCTAAACCAGCAACTTCCTCC
AACTCCATCGCAGCTCCACCTCCACCACCCGCATTTAAAC
CTTCAAAAGAGGAAGAAGAGGAACAGCTCAAAGCAGATAA
AATCAAGCTCGCTTTGGAGAAACTAAAGGAGGCCAAAGTT
AAAAAGCTGGTGGTGAAAGTGGAGATTACGGATGGCAGCT
CGAAGACTCTGATGGTGGATGAGAGACAAACAGTTCGAGA
CGTGATGGACAACCTCTTTGAGAAGACACACTGCGACTGC
AATGTGGACTGGAGTGTGTGTGAGACCAACCCTGACTTAC
AGACTGAGCGGGCCTTTGAGGACCACGAGAATCTAGTGGA
GCCTCTGTCTACATGGACGAGGGACACTGAAAACAAAGTG
CTTTTCCAGGAGAAAAAACACAAGTACGAAGTGTTCAAAA
ACCCTCAGATCTTTTATTTGTGGAAAAAGGATAAGAAATC
TCTAAAGGACATGAAAGAAAAAGACAAAGAACAACTTCTG
GAGGAGAACTTCTGTGGAGCCTCAGTTATTGTGCCTGACC
TGGAGGGCGTTCTGTATCTGAAGGAGGATGGAAAAAAATC
CTGGAAACAGCGCTACTTTCTGCTCCGGGCCTCGGGGTTG
TATTATTCACCTAAAGGCAAGACAAAGGCTTCAAGGGATC
TGGTGTGCTTGGTGCAGTTTGACAATGTGAACGTCTACTA
CTGCAAAGAATATAGAATCAAATACAAAGCACCAACAGAC
CACTGCTTCATGCTCAAGCATCCTCAGATTCAAAAAGAAT
CACAGTACATCAAGTTTATGTGCTGTGATGACGAATGGTC
CATGAATCTGTGGGTTACCGGGATACGTGTTGCCAAGTAT
GGAAAGCAGTTATATGACAACTACAAGGCTGCTGTGAGGA
AAGCATCAGGCTCTGCATCCTGGGCTAACCGCACTATCCA
GGCCTCCTCCACTGCATCAACACCCTCCCCTACACCTAAA
GCCAAAGCTGCAAACGGACATGCTCCTCAGCCTCCAGTGG
AAAACAAGGTTCCATCCAACCAGTCATCATTACCACCACC
TCCACCTTCAATGGATTTCCTGCCTCCTCCACCACCCGAC
CCCATGTTTCCTCCTCCTCCGCCCGCACCACCAGCACCAC
CAGCGCCTCCTGTTCCAGTCAGCTCAACCAAAGTCAACAA
GTTTCCTCCTCCACCTAAATTCCCACAATCCTCCTTCCCT
CCACCAATGGATGATCTTCCTCCTCCACCACCTCCTCCAG
AAATTGCCGATCTGCCCCCTGACTTTCTGCCTCCTCCACC
ACCTAGTTTTGGGTCTCATGGTGGAGAATCACTCCCACCA
CCACCTCCAGACCCCGTCGCCTCCCTTCCACCACCTCCTC
CTGCTTTTACATCTGCAGGCGGAGCACCTCCGCCACCTCC
ACCCCCGCCTCCACCACCAGCTCCAGCACCAGCCGCCAAC
AATCCAGCCGGCAGTGTCAGAAAAGTGGCTCCACCTCCAC
CTAAGAGGACTACTCCTCAACTAACAGCGCCCTCAGGTGG
CGACTTCATGTCAGAACTCATGAATGCCATGCAGAAAAAG
CGCACTCAACCATGAACCTGAGGGTTATGGAATGGACCAT
TGTTTTGGAGTGACATTAGAACACACCGCTTTAATTATGT
TGTTTAAAATGTCTGCATTACACCACCAAAAACATGTACA
TGTAAATACTCATGCAACTAATCATATTAAGGGATGTTAT
ACAATTTCCGGCCACTTTATTAGGTACGTCTATCCAACTG
CTTGTTAACGCAAATTTCTAATAAGCCAATCACATGGCAG
CAACTCAATGCATTTAGGCATGTAGACATGATCAAGACGA
TCTGCTGCAGTTCAAACCGAGCATCAGAATGGGGAAGAAA
GGGGATTTAAGTGGCTTTGAACGTGGCATGGTTATTGGTG
CCAGAAGGGCTGGTCTGAGTATTTCAGAAACTACTGCACT
GAAAAAACTGTTGCATGCAGAACTGTTGCAAACAATTTGT
TTGTGTTGAATTTAAACAACCAAATTAAGTTTAGTAATGT
TCAACTTAATTTGTTTGTTTAAATTCAGCCCAAAAAAAAT
GTTTACAACCTCTTAACATAAAAAAATTGAGTAAATCCAA
GGAATCATCTTTGAATCATTTTTTTCAGTGTGGTTTCTTG
GATATGACAATGAGTTCACTGTACTCAAATGACCTCCACA
GTCACCAGATCTCAATCCAAAAGAGCACCTTTGGAATGTG
GTGGAACGGGAGATTGGCATCAGGGATGTGCAGCCATGCA
GTCAAACATAATGCACTCAAATGAAGTGAGTGACGTCACT
GTGAGGGGTAGGGTTATGGGTGGGGTTAGGTGAGCTCATT
AAAAAGCATCGGATGCAGCTCAGATTGCACTGCACCAGGT
CTGCATCCAAACCCCTCTCCAATATGGACCAAAATCTCTG
AGGATTATTTCCAGTACCTTGTTGGATCTATGCCACAAAG
GATGATGGCAGTTCTGAAGGCAAAAAGGGGTCCAACCAGG
TACTAGTAAGGTGTACCTAATATAGTGGCCGGTAAGTGTT
TAATGAGATAAAATAGATTTTGTGATTTGGCTTAGTGACT
GGTATTAAATATCTCAGTTTCAGAGCTAAAAGAACTAAGT
CCTTTATGCACAACTACAGTAGTTAAAAAAACTGTTTCAA
AATGGCTTACTGTCAATTAATCAAACATCCGATTTTAGAT
GCAATTTTCTCAATCTGACCATGACTGGATAATATTAAAG
AGAGATGTAAATGAGGTGTAATATATTTATATTGTACCAA
AATAAATGTATTACTATTAAAATCAAGGTTGCTTTTTCGG
TGAAAAA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
apbb1ip-201 Contained in:
[BAC] DKEYP-31D1 (1)

Genome Resources: Vega_Trans:OTTDART00000027083 (1),  Ensembl_Trans:ENSDART00000146830 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:BC057421 (1) 3204 nt
CITATIONS (2)