Transcript

slain2-201

ID
ZDB-TSCRIPT-090929-966
Name
slain2-201
Previous Names
  • slain2-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000007426 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000007426|OTTDARG00000006698|ZDB-GENE-041014-251 slain2|OTTDARP00000006599 slain2-001 LG_ BX537133.3 Danio rerio protein_coding KNOWN, 3481 bp
AGTAAAGATGGCGCCGGAGCTTACCGTGTGTACGAGTGCG
ACGAGAAGATGACGACGATACGATTAGTTACTTTCGAGCC
GCGGCGTTGACAGTGCTTCACTTAACGGCCCTGCGACAGA
GGCTCGCGAACTTACTGACTTTGGCGGTAGTTGATCAAAC
CTAACGGACACAACCCGCGCGCGGACAGACCTTTGCTTTT
GCCATGGAGGATATCAACTCAAACATAAACGCGGACTTGG
AGGTGCGGAAGCTCCAAGACTTAGTAAAGAAACTCGAGCA
GCAGAACGAGCAGCTCCGGAGCAGATCCAGTTTACTGTCC
TCTTCCTCCCCTGGCGGGAACACCAGACCGGTGAGCGCCG
GGTTTGACTCCCCGGGAGCGGCAGCGGCACTCGCCGGGTT
CACAGGGGTGGGGTTCGGCGGATCGAGGGGTTTCGATGAG
GCTTTGAAGAACTCCAGGCTGAGCCCCAGACGATCATATC
ACGGCAGCAATTACGGAGATTATGATAGTGACAGCGGTTC
ATTTACCACCTCGAACACGAGTTTCGCGTCTTATTACAAC
GATTCCCTGGATTATATCGAGGACGGAGAAACTTCAGTGC
TGGACGAGGTGGAGGTCCTCGATTTGGAGGACATGGATTG
CCTGTACGAAGAGGAGGACAGCTGGTTGTATGAGGCGAAA
TTGAACAGTCCTCTACAGAAAACCTTGAGTCCCATCGTGT
GGTGCAGACAGGCTCTGGATAACCCCAGTCCTGATATGGA
GTCTGCCAAACGCTCTCTCTTGCACAGACTCGACCTCACC
ATGTCAGGAAACAAGCGGAGGAGTCTATATAACAGCTCCT
ACAGTCCTCAAGTGGGCTACGGAAGCCCATACAGCACAAA
CACAGCAAATAGTCCCTACAGCAGTGGCTTCAATTCACCG
TCCTCCACGCCATCTAGAGTGCCTATCGTCAAGCAGCTCG
TCCTGCCTGGCAGTACAGGTCACCAGCGTGGATCGAATGA
CAGAAATGCACAGGCAGTGAGCCCACAGTCCTCGGTGGAC
AGTGAGTTAAGCACATCAGAGATGGATGAAGACTCTGTCG
GTTCATCAACCACATATAAACTCAATGACGTCACAGACGT
GCAGATACTCGCCCGCATGCAGGAAGAGAGTTTAAGGCAA
GAATATGCTGCAACAGCATCACGCCGTAGCTCTGGTTCAT
CTTGTCAGTCTCTGCGACGAGGAACTTTGAGTGACCAGGA
GCTGGATGCACAGAGCCTAGAGGATGATGAAGAGGCCGTG
CACCACTCCTACCACACACCTGTCAACCGATTCAGTCCCT
CTCCCCGACACTCGCCCCGCGTCTCCCCCAGGAACTCGCC
CCGATCCCGCTCACCCGCTCGCTCTTTAGAGTACAGCCGT
GGGTCTCCCCAAAATATAATCAGCCGCCTTCAACAGCCCA
GACACTCTCTACAGGGCCACGATACCCAAACCAACGCCAT
TAAGAATGAAGAAAAATTGAGGCGGAGTCTCCCTAACCTC
ACACGATCCAGCTCTGGGTCGACTGCAGAGCAAGTCAAAA
ACAGCCGGAGCTGCGAGTCAAATCTGCAAGTGCCAAATGG
AGGGTCACCCCGACATCAGAGTCAGTCTGCCATGCCCTCT
TCCAGTAAGTTGCGGACTCCTGCTGCTCCGTCACCATTGG
CTCTTCGTCAGCCTATGAAGGTCGTGTCTAATCATGGTTC
AGGCACAACCACACCCACCCGCTCTATGGCCCCAACTCGC
AGTGGCCTGCCCCGCCCCTCCACCAATGCTGGCGGAGGTT
TACCAGTGCCTCGCAGCAAACTGGTCCAGCCTGTGCGCAG
GTCTCTGCCAGCTCCAAGGACATACAGTGGTATCAGAGAT
GAGAGCTGGAGAGAGGGCTGCTACTGAGCACAAATGGGCT
TTCTGTTCAACACGGCACTTTATAGAGATACATCTTTAAC
CCCCACAAAAAAGAGACTCATTCTTCCAAACAAATAATTC
TGTCCTCTTTCAGTTGGCATTGCAGAGCTCTCATCCCAGC
AGGATAGATGTGGAAGGCAGGCTGGACGCCATCGAATGCC
AAAGAAACAGAATGGGATTCGCCCTCACCTACCAAACCGC
ACCTGTATCGCAAACGGCTCCAAATCCACAATCCTGCTTG
CAAATCCCCCAAAACCCACCACAGAAGAACATAGAGCAAC
TAGTTTTTTGTAACAAAATTAGTGGTGATCCCTTGTAAGC
ACATGCAGATTGACCTTAACTTTTGGCTCAAGCGAGAAAG
TATGTTGACACACAATCCACAAGGCAATTACATTCTGTCC
GAATGTCTTTCATATCTATGTGACCTCTTATTTATTTGAA
ATCATTATTTAAGATATTCTTTCAAAGAGTATTCACACAG
TATTCGGTCTTTATAAATATAAATATGTATGTTTACTAAT
CTTTATTTTTGGGCTTTTTCTTTCTGAATGTCATTGTTAA
ACCTCAACTGCAAAGCTACATTTCCAAAGCATTTTTAATG
TCTGAATAATGGATGCATTTCAGAGTTTTTGAACTGATGT
TTTTAGTTTAAGTCCTCAGATAGACTGCAGATAGCTTTTG
CTCATTCATAAGGAATCTGTCACAAAAGACAAGGATCAGT
GAGAAATCAAATTTCATGAAATGTGTTTTTATGTCCTGTA
TGGAATTTGCGGAATTCATAGAATATAAATGCCTGAGACA
AATTTCATTGGGTGAACTGTTGCATTGTCAAACTTTGTTC
ATTGGTTGATGTCCCGGTGATAATGTCTAGGTGGCAAGGA
TCCAGAAAAAAAAAAAAAAAAGATGTGGTTGTGTGGGTAA
AGTGTAGTGCTTATGAACTATTCATTTCGGAAAACTCCTG
GTCCTGTAATTTGTTGTCATTCTCAGAGTGAAATAACTGA
TTTAAGGCCAAGAATTAAAAAGGTGTTTACTGATAACTGA
ATGGCAGTGCCACCTGAACATATGAAAATGACATCTTGCT
GCACACTAGCATACGTTTGAGACTGCGCAAGTTTGTTTAA
AAATGAGTGCCTATAATTTATGAAATTCTGTGATCGCTAC
AAATGTTATTTTTTTGGTTTGTGCCAATTGCTTTATTTGC
CAATTTAATTTACTTCAGGGTTCTTTGCATTTCTTGCTCA
AGTTTTATTTGATTTTTGTAATTGCTTTGATAACATTTAT
ATTTGCTTTTTTGTAACAAAGGTATGTTATAAACGGCCCT
TGCTATTTATGACGAAATACTATGTGCGCTGATAAGAGGC
TTATTTATTGAAAGGTGAGATGCCTCCGTGTGCTGAGATA
TAGAGTTAGTGGGATGCTTGAGCCTAGTATGGTCATGAAT
AAATGACATAAACATTTTGTGGATTGTTTTTTTTTTTTTT
TAGTAAAGACTTTTATATCTCCACAAACATGATGCTCGGT
TTCCCCTGCGTTAAATCATTTCAAATAAAAGTTGAAAAAA
A

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations