Transcript

gabarapl2-201

ID
ZDB-TSCRIPT-090929-9521
Name
gabarapl2-201
Previous Names
  • gabarapl2-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000026930 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000026930|OTTDARG00000021242|ZDB-GENE-040718-336 gabarapl2|OTTDARP00000022074 gabarapl2-001 LG_ BX890570.11 Danio rerio protein_coding KNOWN, 1079 bp
CTAGAAACGCTTCACTTCGTGAACAATAGGATTATTAGTG
TACATTGTATTTAAAACAAACACAATGTAGTGTAATAACA
TAGTTTATACTGCTCTAAATATATATTTGCTTCAAATATT
TATGAAATTGTGTATAAGAGCACCCGAATAGGCTAAATGG
TACGGCTCCGCCTTGACGTCAGCTTCTCTGACGCAGCGGG
TCTGTACGCGGTGACGTAATCACGGCTCGTCTGAAGACGA
ATGTCTGCTGCTGCTGATACATTGTTGACGTTTTTAGTTT
TGCCGTTTAATTGACTTTAAATCATCCGATACTTCCACTA
ACAGGTCGCTCCTCGAGCAAAACCTCCGCAAAAATGAAAT
GGATGTTTAAAGAGGACCATTCTCTGGAGCACAGATGTGT
GGAATCGGCCAAAATCCGCAACAAGTATCCAGACAGAGTT
CCTGTTATTGTGGAGAAGGTTTCTGGGTCGCAGATTGTGG
ACATCGACAAGCGGAAGTATCTGGTCCCGTCTGACATCAC
AGTGGCCCAGTTCATGTGGATCATCAGAAAGCGGATTCTG
CTGCCTTCTGAAAAAGCCATATTCCTATTCGTCGACAAAA
CTGTCCCTCAGTCCAGTCTGACTATGGGGCAGCTCTACGA
GAAAGAACAAGACGAGGACGGCTTTTTGTACGTGGCCTAC
AGTGGAGAAAACACGTTTGGATATTAATCTCCCGCATCTT
CCTCCTCCTCCTCCTCCTCACTCGCGTTTCTTTTGGACTT
GCTGGATTGCGAAAGCGGATCTGTGACATAATAATCACAC
ACAGCAGACGTGTTTGTACTTCTGTCGTCACCCGTCATAT
TGTGCTCTCAAACATTAGATCCACAGCATTAGTGATTGTT
TTCCCTCTTCTTTCGGTGAATGGTGTTGCAGTATTATCAC
AGACGCTTCTTAATAATGTCGACACGGAGAATATATATAG
TCACTTTTAATGTTTTAATTTATCTGTATTCTTTTTCCCC
TGTAAATTATGTATTTAAGATTACTGAAAGGTAAGGTAGC
TGGATGACCTAACCAATAAAAACCGACACCAAAAAATTA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations