ZFIN ID: ZDB-TSCRIPT-090929-9401
Transcript Name: cab39l1-201
Previous Name: cab39l1-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000026786 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000026786|OTTDARG00000021161|ZDB-GENE-040426-2897 cab39l1|OTTDARP00000021958 cab39l1-001 LG_ BX511227.7 Danio rerio protein_coding KNOWN, 4424 bp
AACTTCCCTGATAAAGTAAAGCGGCAGAAGCTTGAAGTGT
ACGAGCAGCAAACCACTCCTAAATTAATCGCAGTTACTAA
ACCCCGAAATTATCTCCTTTTGGAGAGTTAAATACTATGT
TCGTCATAGCTTGAACTGGATTAATAGCTTTATATTTAGC
TGCTCGCAGATCCATCCAACTTTGGTCCTCATCGCGGTGT
TTGGATTATAAATTGGACGTTTTAAGTCTGGTGAATGCGG
TGAAACATTTCCATCGTCCTTCCACATCCAACGCACATCC
CAGCTAAAACCATGCCGTTCCCATTTGGGAAGTCTCAAAA
GAGCCCTGCAGAGATTGTAAAGAGTCTGAAGGAGAATGTG
GCATACTTGGAGAAGCTGGAATCATCTGAAAGCAAGAAAT
GTGAAAAGGTTGCAGAGGAAGTATCTAAAAATCTCTCGTC
GTTGAAAGAGGTGCTGTGTGGCACCGGAGACAAGGAGCCT
CAGACCGAAGCAGTGGCCCAACTGGCTCAAGAGCTCTACA
ACACCAACCTCCTCATTTCCCTCATAGCAAATCTACAGAG
GATTGATTTCGAGGGAAAGAAGGATGTGGTGCATCTGTTT
AGCAACATAGTACGTCGCCAGATTGGTGCTCGCACGCCGA
CTGTGGAGTACATCTCTTCTCACTCACAAATCCTCTTTAT
GCTGCTGAAAGGCTATGAAACTTCAGAAGTGGCTCTAAAC
TGCGGAATGATGCTGAGGGAGTGTCTGCGTCATGATCCTC
TTGCCCGAATCGTTCTGTTCTCTGAGGATTTCTACTGCTT
CTTCCGCTATGTGGAGATGTCTACCTTTGACATTGCCTCT
GATGCTTTTGCATCATTTAAGGATCTCCTGACAAGACACA
AGATCATGTGTGCTGACTTCTTGGAGACAAATTACGACAG
AGTGTTCACAGAGTATGAAAAGCTGCTGCATTCTGAAAAT
TATGTCACCAAGCGCCAGTCTCTGAAGCTCTTGGGAGAAC
TACTGCTGGACAGACACAACTTCACAGTCATGACCAAATA
CATCAGTCGAGCTGAGAACCTAAAGCTGATGATGAATATG
TTGAGAGACAACAGCCGCAACATCCAATTCGAAGCCTTCC
ACGTCTTTAAGGTGTTTGTGGCAAACCCCAATAAGACACA
GCCTGTGCTGGACATCCTCCTCAAGAATCAGTCCAAGCTG
GTGGAGTTCCTGAGCCACTTTCAAACGGACCGTTCTGAAG
ACGAGCAGTTCTGTGATGAGAAGAACTATCTCATTAAGCA
GATCCGGGACCTCAAACGGCCTGCACCGGCAGAGGAGTCC
TAATGGGAAGATGTGGAGCGTAGAACCGGGGCGCTCGGCT
AGTGACATGGTTTGATTTATGTGGGGTGAGATTTGGATTG
AAGGGAAAGTCAAAGAACGAAACAAAGAAAGGCATCGCTG
GGAATAAATCTTTTTCATATAACCTGGTTGAGAAATGCTG
TCAGGATGTGCAAACACATGTCTGTCCCTTTATTTGGGGC
GAGCAGGTTTTTGCTGCAGGAGGAGCATGTGGAACTGAAA
CACTCCATTTAAACCTATATACAATTTGAGCACTGCCCTT
ACAAAAGAAGGCAAATCGATTCGCCTTCATATGGTAAATT
AAAACATTTATCCAAATTCATCCGTTCAGGGCTTTTTAAT
ATTGTTTTTAAAAGTTAGAGTAAGCACATTGGTACAGGTA
TGGCTTTGCATATTTGCACTAAATCTGAGAGCTTTGCTTC
AGGTTGGCCATTAGTGCCAGTTCTTAATCTCGCAACAAGA
AAACCAAATGTTAATGAACACACAAAGAAAAAATACTAGA
TCATAAATACAGTAGAGTATGGGGCCATCTTTCCAGCAGA
CGAACACCAATTTAATGGGACATTCTCACGTTTAAACTAG
TTAAAGGACATTAAAGCATTTTAATAGCCAGAAAATGTCA
TGTGGTTAAGCAAAACCTTATCTTTGAGGAAAAATAGCCC
GGGGAGTTCAGTGGTCATGCTGCACTCCATTTCCAATTTT
AACTGGGTGCCTTATTTAAAAAGTTTGCTCATTCTGGGTC
TTCTATTACATTTATTTATCTATAACATTGGATTTGTAGT
ATTGCTCTGCTTTTGCTTGGGTTAACACCTTTAGGAGTAC
TAGTTTTATTTTAAACTATTAAAACATTATGTGAAATAAC
TGAAAAGGTAATACTCCTTTAAAAAAATTTTCTCAGTTAA
AAAGAGGTTCACCCCAAAATTTTGTAATTTACTGACACCC
AGGCAATCCAAGAGGTGACCCCTTTTTCCAGTAGATTTTA
GTTAACCTTGATCTTGATTAGATTTCAATTTAAAATGAAT
ATCACTGGCTGTTGGCATGTTTAGAGCTAAAAAAAAAATT
AAAAAAAACCATTAACAGCGTTTTGCCTCGATAGGTTTTT
ATTCTTTTTTTTTTTTTTTTTTGACTCTCAACGTACTGGT
AGCTTTACGTTGACTTTAACTTTGATTTATTTATGATCAC
ATTTTGAGCAAAAGAAGTCGCCAACATCTTGGATGCCTAA
AAATGCAAGTAAATTAACAGCAAATTTAAATTTTGAGGTG
AACTCTGCATTTAAAATAAACTGTGAAATCAACTCTAGTG
GGAAAACATGGTACACAATTACAGTGCAAGACATGATAAC
CTCCACACACACACACACACAAACACTGTAACCCTGAAAA
AATGTAAAAAGCCGAAGCATGTTGCGAGTTTCTTCATGCT
GCATTTTGATGGACTTCGCTTAGACTAGCCAATTAAGCCT
TTAAAAGATGGATGCAATAGGAAAGACTGTTTAACACCGT
TCTTCATGTCCTGCACTGTCAAACTTGAATGAGCCAAAGC
CGTGGTAACACACGTTATATCTTAAGATGCCTGACTATGT
ACAACTATGGATTGCACTTTTCAGTACGTCTTTGACGTTT
TCGATGAAATGCAGAACAGGATTCTACTGAGAGGTTTCAC
CATTAGTCTTTATACCCTAAGTTGAATATGTTTTATGTAC
TCTGTTTGCACAAAAGTTCCTTTCTTATATACCTCATAGG
TTTTAAATTCCTAAGTGCTGTTTTTTTTCCCCCCTCTGCT
TCGATTAAATTGATATTGTAGTAACACTTTGCAGTAAGGT
CAGAGATTTTATTGATGTTTCAATTGGAAAAAATAACAAT
AGTTTGTATTATGAATTAATGAACAAAGTGTGCAATTAAG
ATGTGTTAATTAAAAGGAATAATTAACCCAAAAATGTAAA
TTTTACTAACCTTTAAGTGGTTTCAAACCTTTTGTGATTT
TTGTTGTTGTTTAAAGCAATATATTTTGGAAAGGGGTAAC
CATCTGACATCTATATTAGGAAAAACAAAATACTATGGAG
GTCTGTGCTATGGCTACCAGTTCTGTACATTTTCTTTAAA
ATCTTTACATTTCAACTGTTTTGGAACCGGTGGAGGGGGA
GTACATTATTTATTTTTTTGGGTGAACTATTCATTTTAAT
GCTAGCAAATCAAACCTTATTGTAAAGTGTTTCTGGTATT
GTAGATTTAGAGTGTAGTTTGAATTATGCAAGTCTAAAAA
AGACCTTACAACATGCCACAGTTGTGGTCTTGTAATGCTG
AATAGGACCTACAAGGGAAACTATTGAATCTTTGCAGTTT
GCTAATGGGTACATAGAATGTTACTCACTGTGCTTTTGTA
AATGAGCCACAGTTTCACTCCAAAATGTTTTTAATGAATG
CAAATGTTTGCTTTTGCTTTGACATTTTTCAGTCAGCTCA
TCGCCAGAAGCAAAAAACCAAACATTTTTTATTTTGCAAG
TCTGACTTGTGCATGCGGAACTTTATTGTATTTTGGAGGG
AAAGGGGGAAAACCTTCAGAGCTGCCTTTCTTTGTTTTGT
ATAAAATGTAACCTGTGTAAAATCACGAAGCCTTTGTGTT
GAACGGGGGCACAGACAGATTCACCCCCCCTTTAAAAAAA
TATCTCCAGCTATCTATAACCAAACATTTCCACCATTTCA
TTAAATGTCACTTGATACCACAAGTACAAGAATGGGTGTT
CAGCCAAATGTGATTATTCCGCTGACAGGGTTTTAAAGGA
GGTTTTGTCCTTAAGCTTGTTGAAGCTTTGAGCCTTCAGA
TTCTCCATGCAGTGATAGTGATCTCTGAGGACAAAGAGAT
TCCAAATAATGTTTAATCTTTGATAAGTTATTACGGTGCA
TTATATTCACCTTTATTATTTGCAGTTTTGACTGATAATG
TTTGCTATGCTTTCACTGTTTTTCACTCATTTTCCTACGA
GTTTTCTGTTCTATTTTCCACTGTGGGAGAGGACTATGTA
TGTACATAAAGTTTTATTTTAAAAAGACAAGTGTGGAGGC
ATATTGGAAATAAAACAAACAACA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
cab39l1-201 Contained in:

Genome Resources: Vega_Trans:OTTDART00000026786 (1),  Ensembl_Trans:ENSDART00000018347 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:BC044172 (1) 2366 nt
GenBank:BC164384 (1) 1099 nt
GenBank:DN902681 (1) 821 nt
GenBank:CF348803 (1) 767 nt
GenBank:CV490555 (1) 762 nt
GenBank:EB915968 (1) 732 nt
GenBank:CK692369 (1) 731 nt
GenBank:BQ284908 (1) 712 nt
GenBank:EB976682 (1) 488 nt
GenBank:EE213785 (1) 481 nt
GenBank:EB915983 (1) 292 nt
CITATIONS (2)