header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-9370
Transcript Name: fabp10a-201
Previous Names: fabp10-001, fabp10a-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000026751 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000026751|OTTDARG00000021139|ZDB-GENE-020318-1 fabp10a|OTTDARP00000021931 fabp10-001 LG_ CR293507.10 Danio rerio protein_coding KNOWN, 525 bp
GCTGACCTTCACTTTGTGTTGAGCTTCTCCAGAAAGCATG
GCCTTCAGCGGGACGTGGCAGGTTTACGCTCAGGAGAACT
ACGAGGAGTTTCTCAGAGCCATCTCTCTGCCAGAAGAGGT
CATTAAACTGGCCAAAGATGTGAAGCCAGTGACAGAAATC
CAGCAGAACGGCAGCGACTTCACCATCACCTCCAAAACTC
CTGGAAAAACCGTCACCAACTCCTTCACCATCGGCAAAGA
GGCTGAAATCACCACTATGGACGGCAAGAAGCTCAAGTGC
ATCGTCAAGCTGGATGGAGGAAAGCTGGTCTGCAGAACTG
ACCGATTCTCCCACATCCAGGAGATCAAGGCTGGAGAAAT
GGTGGAGACGCTGACAGTCGGAGGAACCACCATGATCAGG
AAGAGCAAGAAGATCTGAAGCGTTTCACCATAACTCTATT
TAAATAAAGCTCTGACTGACAAAAACACTCTGATTATTGA
TTCACTAAAACACTTTAATAAAAACTGTACCGGTCATACT
TTAAA

fabp10a TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA fabp10a-201 525
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
fabp10a-201 Contained in:

Genome Resources: Vega_Trans:OTTDART00000026751 (1),  Ensembl_Trans:ENSDART00000056095 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:CN170250 (1) 574 bp
GenBank:EH497649 (1) 476 bp
GenBank:BC076219 (1) 468 bp
GenBank:BC081518 (1) 466 bp
GenBank:AF254642 (1) 441 bp
CITATIONS (2)