ZFIN ID: ZDB-TSCRIPT-090929-9140
Transcript Name: kctd16a-201
Previous Name: kctd16a-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000026466 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000026466|OTTDARG00000020967|ZDB-GENE-060117-1 kctd16a|OTTDARP00000021707 kctd16a-001 LG_ BX470157.7 Danio rerio protein_coding KNOWN, 918 bp
ACGTTTTTTGAAGAGTAACACACCGAAATGGCCCTGACTG
AAAATTGCAGGACTTATCAAACGCCCAAGGACAGTGGATG
TGCTCAGAGTTGCTCTTCTGATGTGGTGGAGCTCAATGTA
GGTGGACAGGTGTACTACACTCGCCATGTCACCCTCACCA
GTGTGCCAAACTCACTGCTGGGTAAATTGTTCTCCTCTAA
AAAAGACATTTCTAACGACCTCACGCAGGACATCAAGGGA
CGCTACTTCATCGACCGGGACGGATTTCTCTTTAGGTACG
TGCTGGACTATCTCCGCGATAAGACTGTCGTCCTGCCGGA
TTATTTTCCGGAGAAGGGGAGGCTGAAACGCGAAGCTGAG
TTTTTCCAGCTGCCCGAGCTCGTCAAAATCCTAACCCCAG
ATGATTATAGTCACAGTGATTTTGACGAAGCATCCCAGGG
AAGCGACCAGAGGTTATATCCAGCCTCTTACCTGGACGCG
CGCGACCGACGCTACGGCTTCATCACGGTCGGGTACAAGA
GCTCGTGCGCATTCGGGAGGGACACTGATCCCAAAGCCCG
CGGAATACCCAAAATCTTCATTTGCGGAAGAGTCGGTCTG
GCGAAAGAAGTTTTCGGCGACGCACTAAACGAGAGCCGGG
ATCCTGACAGACCGCCGGAGCGTTACACTTCTCAGTTTTA
CCTGAAGTTTCGCCACCTGGAGCGAGCGTTTGATATGCTC
GCGGAGAGCGGGTTCCACATCGTCGCGTGCAATTCATCAC
TCACCACATCTCCCCACAACAGGCATGCTGATGATAGATA
CTGGTCCAACAACACAGAGTACGTCTTCTATCGTAAGTAC
AGCTTATTTACTCTTTACGTTGTATTACAAAAAGAAAGAA
AATAAAGCCATTTGGCAATGCTGGGTAGTTACTGATCA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
kctd16a-201 Contained in:
[BAC] CH211-119P14 (1)

Genome Resources: Vega_Trans:OTTDART00000026466 (1),  Ensembl_Trans:ENSDART00000014411 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:AY763407 (1) 918 nt
CITATIONS (2)