Transcript

kctd16a-201

ID
ZDB-TSCRIPT-090929-9140
Name
kctd16a-201
Previous Names
  • kctd16a-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000026466 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000026466|OTTDARG00000020967|ZDB-GENE-060117-1 kctd16a|OTTDARP00000021707 kctd16a-001 LG_ BX470157.7 Danio rerio protein_coding KNOWN, 918 bp
ACGTTTTTTGAAGAGTAACACACCGAAATGGCCCTGACTG
AAAATTGCAGGACTTATCAAACGCCCAAGGACAGTGGATG
TGCTCAGAGTTGCTCTTCTGATGTGGTGGAGCTCAATGTA
GGTGGACAGGTGTACTACACTCGCCATGTCACCCTCACCA
GTGTGCCAAACTCACTGCTGGGTAAATTGTTCTCCTCTAA
AAAAGACATTTCTAACGACCTCACGCAGGACATCAAGGGA
CGCTACTTCATCGACCGGGACGGATTTCTCTTTAGGTACG
TGCTGGACTATCTCCGCGATAAGACTGTCGTCCTGCCGGA
TTATTTTCCGGAGAAGGGGAGGCTGAAACGCGAAGCTGAG
TTTTTCCAGCTGCCCGAGCTCGTCAAAATCCTAACCCCAG
ATGATTATAGTCACAGTGATTTTGACGAAGCATCCCAGGG
AAGCGACCAGAGGTTATATCCAGCCTCTTACCTGGACGCG
CGCGACCGACGCTACGGCTTCATCACGGTCGGGTACAAGA
GCTCGTGCGCATTCGGGAGGGACACTGATCCCAAAGCCCG
CGGAATACCCAAAATCTTCATTTGCGGAAGAGTCGGTCTG
GCGAAAGAAGTTTTCGGCGACGCACTAAACGAGAGCCGGG
ATCCTGACAGACCGCCGGAGCGTTACACTTCTCAGTTTTA
CCTGAAGTTTCGCCACCTGGAGCGAGCGTTTGATATGCTC
GCGGAGAGCGGGTTCCACATCGTCGCGTGCAATTCATCAC
TCACCACATCTCCCCACAACAGGCATGCTGATGATAGATA
CTGGTCCAACAACACAGAGTACGTCTTCTATCGTAAGTAC
AGCTTATTTACTCTTTACGTTGTATTACAAAAAGAAAGAA
AATAAAGCCATTTGGCAATGCTGGGTAGTTACTGATCA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations