ZFIN ID: ZDB-TSCRIPT-090929-9080
Transcript Name: hibch-201
Previous Name: hibch-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000026405 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000026405|OTTDARG00000020934|ZDB-GENE-050327-29 hibch|OTTDARP00000021665 hibch-001 LG_ BX323586.10 Danio rerio protein_coding KNOWN, 2193 bp
GAGCAGTCGCGACAGGGTGAAACCTTACTGTGCACAGTGA
TCCAGAACATCAAAGATATGAGCATGTCGTTAATAATTTT
CACATCTGCACAGAGATTGCGATCAGTCTGTAGATTGCAG
AGAATACATGGACACATGATGTCCAGTAAAGCTGGATCTG
AAGTTCTGTTTGAGAAAGTGGGAAAAGCCGGAGTAATCAC
ACTAAACAGACCCAAAGCTCTGAACGCTCTCACACTCAAC
ATGATCAGACACATCTACCCTCAGCTCAAGAAATGGGACA
AAAACTCGGAAACGGATGTAGTGATTATTAAAGGAGCAGG
AGAGAAGGCTTTCTGTGCTGGTGGAGATATCAGAGCAATC
GCAGAGGCTGGAAAAGCAGGCGATTCTCTTTCCCAAGTCT
TTTTCCGCGAGGAATACATCCTTAACAACACTATTGGTAC
ATATCAGAAACCCTATGTGGCTCTAATTAATGGAATTACA
ATGGGAGGAGGTGTGGGTCTTTCAGTTCACGGACAGTTTC
GTGTGGCCACTGAGAAGACACTATTTGCCATGCCAGAGAC
GGGCATTGGTTTGTTCCCTGATGTCGGTGGTGGCTACTTT
CTGCCTAGACTTCAAGGCAAGCTGGGCCTTTTTCTCGCCC
TGACAGGTTTCCGCCTCAAAGGACGAGATGTCCAGAGGGT
CGGGGTGGCTACTCACTTTGTGCAGTCAGAGAAGATTGAA
TCTCTAGAGAAGGATCTTGTTGACTTGAAGTCTCCATCTA
TCAGCGATGTGGCTCAGCTACTGGACTCTTATCAGGAACA
GAGCCATCTGGATGCTGAGAAACCGTTTGTCCTCCAGGAA
CAGACAGAGGCCATCGACAGGCTATTTTCAGCTGGAAGTG
TAGAGGAGATCGTGGAGAACCTTAAGAAAGATGGCTCGGC
ATTTGCACTGAAACAGGCTGAGACTCTTGTCAAAATGTCA
CCGACTTCACTGAAGTTAACTTTCAGGCAGATTGAGGAAG
GAGCGAGAATGAGTATGCAGGAGGTGTTCATGATGGAGTA
TAGACTCAGCCAGGCCTGTATGAACGGCCACGATTTTTAT
GAGGGGGTCAGAGCAGTGCTAATCGATAAAGACCAGAGTC
CAAAGTGGAAACCTTCTACCCTGGCTGGAGTCTCAGTTCA
GTTTGTAGACAAATGTTTCAGCTCTCTGGGTGAAAGAGAC
CTCAAACTATAGAAAGTCATTTCAAAAATCCCGCAAGTTG
CTTTTTCACAGATCTCTGAAATTTATCAAAGAAATCTGCA
TTGTTATTTCTGTCAGCATATAGTAGCTGACGAAAGCAAA
AATACTTCTGCTGCTTACAGCTAAAGCAAATGTTCCTCTG
AGGCTTCTGTGAGGCCTCTCTGAAATGATGAGCAATGCTG
ATTTCTTCTGGAAGTTCAGAGGTTTGGGGAGTGTCTTGAT
GCCATTCTACTGGGAAATGGCATTAAGGGAGAGTTAACAA
TTGAAAATGAGTATGTCATTATTTACTTAACCCCAGTTAA
ACGTTTCTGTTTTTATTTACAGTTGTTAATATCAGAATTT
TGATAGTCATGCAGGTATTTTCTGTGAATTAAAATATGAG
GTGTTCATACTGGGTATAAAATGACAAAAGTGATATAATG
ACACAATTTTGAACAAAATTTAACAGCACTCTGTTTAAAG
TGCTGGGAATCGTATCTTGCATACTTCATTGTTAAAGGTG
TCTTTTTTCCCCTCTAAACTGTGTAATCGTTTGTGTAAAT
CCTGTGGAAATAGATTGGCAGACACTGATTTTTGCACATG
CTGCAATCCGTGATTAACCTTAACACATGCCCTGGCCACG
ATTCAGTTCGGTCGGATTAAAGTATTGTCATGTGATGCAC
AGTATGCAATATGACTGCCATTAACCACAGTGCTGTTTAC
TACACAAGTCCTTCCTCTGGCATAAATGTATCAAGCTTGA
TATATTAAATCTGAATGACGTTGACACGACCATGATGCCT
TGAGTTATAACGATTCAGTCCTTCTTTGCTATGCCGATAT
AACTGCGTGGATGTTGATTTAAACTGCGTGACCTATATTT
CATGAACAAAAAAAATAAGATTGTTTTGTATCCACTTTTG
GTTTTGATTGCAGAAATCTCATGTAATCTTAACATGCCCA
CAGCACATCTCAATAAAAACAAAGGTGTAAAAA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
hibch-201 Contained in:
[BAC] CH211-3O3 (1)

Genome Resources: Vega_Trans:OTTDART00000026405 (1),  Ensembl_Trans:ENSDART00000141548 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:BC091995 (1) 2185 nt
GenBank:EB923044 (1) 174 nt
CITATIONS (2)