header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-905
Transcript Name: si:ch211-153j24.3-202
Previous Name: si:ch211-153j24.3-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000007037 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000007037|OTTDARG00000006382|ZDB-GENE-041014-38 si:ch211-153j24.3|OTTDARP00000006260 CH211-153J24.3-001 LG_ AL929435.16 Danio rerio protein_coding NOVEL, 1203 bp
AAAGAGAAGAAGCGCTGATGGCTGGTGCCTCCTAGCGTAG
TAACCTCAGTCTAGAGATTTATTTTTTCCTGCCTTCCTCC
AAAAGCCTGCATTTGTTGACATTGCTCATATATTAATTCG
GTTTCCAGCATTTTCCTGGCGCGACCTACAGTAGCATTAG
TGATGCCAAAAAACGCGAGTGTTTCTGCAGAACAGCTGCT
GCACACATCAGCTGCTGGGATGAAGGATACGCAGAAGGCA
GGTGTTTTGAAGGATGCTGATGCTGCCTTTGTTCCTACGG
TCACTGCTGTTGCTTCAGCTCCAGATCTCAAGTGGATGGT
CCTGTCGACTGACATCTCTTCAGTGTCACCCTGCAGACAG
CAGAAAACACAGAGCTCATCTCACTCCACAGATGCCAAAG
CTGCTCGAAAGACCTTCACTGGCAGGAGAAAGGGGGCAAA
GGATCAGCTTTCTCCAGAGGAAGAGGAAAGAAAAAGAATC
AGAAGGGAAAGAAATAAACTCGCAGCTGCCAAGTGTCGAA
ATCGTAGGCGAGATCTAACCAACAGCCTGCAAGCTGAAAC
CGACGGTCTGGAAGAAGACAAAGCGGCTCTGCAGTCTGAG
ATCGCCAGCCTGCTGAAGGAAAAAGAGCGACTGGAGCTCA
TCCTTTCAGCTCACAAACCACACTGTAAACTCACAGAGGA
GACGGAGAATGAGGAACCAGCTCCAGCCCAGGAGGAGAAG
ACTCAAGCTGCCAGTGTGCCAGAGCAGGTGCCCGCCTCGC
CCCCGCAGGCCGATCCCACCAGCGCTGCCATCTTCGGGGA
CTCAGACGTCCTGCTGTGCTCCAGTGCTGAACTGGGCGCT
GCCGAGGTGGAGCCGTACATCGACATGAGGGATGTGTGCA
TGGAAGATATCAGCAGTGTTATAGACAGCGGCGATGACAT
GGATCTGTTAGTGCCGGATATCGACCTGAGCAGCTCTCTG
GGTCTCAGCGAATGGGAAACGCTGTATATGTCGATGGGCG
GCGGGCTGGAGCCTCTGAGCTCGCCCACATGCAGCCCCAG
CACCGATGCTGTGCCCGTCTTCAACTTTACTGACGCAGAT
GCTGAGGATCATGATACCGGTAAAGAAGAGGGAAAATCAA
ACGCAGCCAAAGAAATGATGACGACTTTATGAAGGGTTCT
GGAAAGCCACAGTGTAAAAATATAGATCTGTTAATTAGCA
GTT

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
si:ch211-153j24.3-202 Contained in:

Genome Resources: Vega_Trans:OTTDART00000007037 (1),  Ensembl_Trans:ENSDART00000122115 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES No data available
CITATIONS (2)