Transcript

st3gal7-201

ID
ZDB-TSCRIPT-090929-9036
Name
st3gal7-201
Previous Names
  • st3gal7-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000026359 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000026359|OTTDARG00000020910|ZDB-GENE-060322-2 st3gal7|OTTDARP00000021634 st3gal5l-001 LG_ BX294129.10 Danio rerio protein_coding KNOWN, 2714 bp
ACTCACAACACCACAGCGGATGAAAGACAGAAGCAGAGCT
CAAATTCAGCACAACGCCGACATGCTTCATCTCCACAGCT
GAGAGAAGGAAAAAAAAAGACCTGATAGAAGAGTAGGAGT
ATTTGGGAAGTGATTGGGAAAATGGTGACTCTGAAACACT
TGAGTGTTAATGATAATGATGAAGACGGTGTTCCTTTGTT
ACCGGAAGCCAGCAGCTTGGAGAGTCCAACCACACAACAC
AGCAGGGCAGAGTCCAGAGATTTCTTTCTCAGCCGGAGGT
ATAACTTCATTGTGAGCATCGTTCTGCTGTTGAGCCTTTA
CTCTGCTCTTCTGGTTCCTGCATATCTGCCAACAGCAGAG
CCCATCTGGACTAATGAGAGCTCTGCTGAAAATCTGGCTC
TGCTGAATCAGTCTGCATCTCTGCTGTCTCAGTCATGTCA
CAGCGGCTGGAGTGTAGAGAGGATGAGGACTATGTTGTCC
ACTCCAGCCGGTCTGCTGAAGATCCCTGTGTTCTTGGAGA
ACGGCACTGGAGATTGGGCTCTGCCTCCTCCGCTGGGTCT
GCAAGGCAGTGAAGAGATGGCAGAGCAGGCCCTGAAAGCT
CTGCCATTCACCGCTGTGCCAACCGGACCAGAGACCTGTA
GGAGATGTGTGGTGGTCGGAAGCGGCGGTATTTTACACGG
CAAAAATCTTGGAGCTCATATAGACCAGTACAACATTATC
ATTAGAGTGAATAATGCTCCAGTGTTTGGATTTGAGAGCG
ACGCTGGCTCAAGAACTACCATTCGCCTCATTTATCCAGA
AGGAGCTCCTTCCCACATACAGGAATACGAGAGAACTGAA
GTCGTAGCTTTGGTTGTGTTCAAGAGTTTAGATTTAGCAT
GGATGACCTCGGTAGTAACCAAAGAGCCTTTGAGCTGGTG
GTCTAAACTGTGGTTCTGGAAGGATGTAATAGACTCAATA
CCTCTACAGCCAGAAAACGTTCGCATCCTGAATCCCGAAA
TCATGTACAGGACTGGACAGGTGCTGCAAACCTACGCAGA
ACAGCAGAGAAAGATGGTGCCAACTCTGGGTATAACCGCA
GTGGTTGTGGCCCTGCAGGTGTGTGATGAGGTGAGCATAG
CTGGATTCGGATACGACCTGCAGCACCCTGGAGCTCCGCT
ACATTACTACGGCTCTCTCCGCATGGACGCCATGAAGACG
CAGGTGGTTCACGATGTTAGTGCCGAGACTGTCTTTCTGA
AAGAGCTGGTCAAAGCTGGAGCGGTGCGAGACCTCACTGG
GGCACTGTGAGAGACCACTGCAGACACTCCACAACAGCTG
AAAGAAGAAATGAAGAGAATGAAAAGCAACAGAAAACACA
ATAGATTTATAGCATGCTGTTTCGACCATTCTCATGATAT
GATATACAGCTGAAGTTATTAGTTATTATGATATACAGTA
AATTATTAGCCCCCCCTGTAGATTTTTCCCCAAATTTCTG
TTTAACAGAAAGAAGATTTTTTTTCAACACATTTCTAAAC
ATAATAGTTTTTAATAACTGATTTATTTTATCTTTGCCAT
GATAACAGCCTATAATATTTTACTAGATATTTCTCAAGAT
ACTAGAATTCAGCTGAAAGTGAGATTTTTAAGGTTTAACT
AGGTTTATTCCAGTAAGCTAAAGTAAGGGTAATTAGGCAA
GTCCTTGTATAACAATGGTTTGTTCTGTAGACAATTGAAA
AAAAAATGTTTTAAAATGTTTTTAAAAAATTTTAAACTGT
TTTTATTGTAGCTGATAGAAAACAAATAAGACTTCCTCCA
GAAGAAAAAAAAACATTATTATAAATACTGTGAAAAATTC
CTTGCTCTGTTAAAGATCATTTGGGAAATACTTGAAAAAA
AAAAGAAAGAAAAAAAAAAATCACAGAAGGGCTCATAATT
TTGACTTCAACTGTATTAATATAAACAATTCAATACCTGA
TATCAAAATTAAATTATTGATATCAAGTATTGCATTTTAT
CTAGAAAAACTATTTAATATGTAATTATTTATATCTTTGT
ATTTTCATTTAATGTCTCCATCGGCTGCTACTCAAATTTA
ATTGCTGATTTTAATAATTGAATACTTATTAGTAATTATT
CCAATGTTCCAATAGTTCAAAATGTGACTGGACATTGTGA
AAACTATTGGGTAAATGTTGGGATAAAATACAATACAGAC
ATTACCTAACTTAAATTTAAAATGGGAACATGACAGCTAA
ATTAAAACCAAAGCTATAATACATAACATCTATAAAACTA
AAATAAAACACTTTTTTTACTTAAGCTTTATAAAAGATGA
CAAAAAATTGTTCTGAAAATTATTTCATATTTATTTATCT
CGTCAAACACCAATACATATTTTACATATTGTGTAAAAAA
TGTTTTAGATTCTGTATTTATTCAAGCAAAGTATAAATGA
GATTTCAGCGTACAGAGAAAAACATTCAGTCATGTAAAAA
AACATCACTTTTATATTTTAACACCTAAATCAGAGAGTAA
AAAACACTTTCGCTAGATTTCTTTAACTACAATTTTAACT
CGGGGAATGTTTTGTTGTATGTGTGTAACAACATTCATGA
TCAAGAATTACAGCTACAAAAAAAAAAAAAAAAGTGTTTC
AAGAAATGAATTCTGCTATGCGATACATTGGATGTTTTTG
GCTGCTGGACAAATAAACTGACACTTTTCTTTTA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations