Transcript

sec22a-201

ID
ZDB-TSCRIPT-090929-8986
Name
sec22a-201
Previous Names
  • sec22a-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000026305 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000026305|OTTDARG00000020882|ZDB-GENE-030131-3553 sec22a|OTTDARP00000021593 sec22a-001 LG_none BX511075.5,CU896658.10 Danio rerio protein_coding KNOWN, 1600 bp
TGTTACGAGTTTAGCCGAAGCTGTGTCGTACGTAAGCAAA
AACCGTCCGCTATGAGACCCGCAGGAAGAGCTCAACGATC
AAGATAGTATATCAACAAAATAACTCAAAAGGGTTATAAT
GTCTTAATATATTTTTAATCGGCTCATGTCAGTAGGTGTC
AACTGAGCTTTCTGTAAGATGTCTATGGTCCTGTTTGCCT
CAGTGGTGAGAGTGAGGGACGGTTTGCCTCTCTCAGCCTC
CACAGACTATGAACTGGATAAAGGAATTCAGGAGACAAAG
AAACATCTCAAGGTCCTGTCCAAAAAACTCAGCCAGTTTC
CTGATCGCTGCTCACTCAGATCTGGACTATACAATATCAA
CTTCACAAGCTCTCTCGGAGTTGGGTACTTGATGGTTTGC
ACAGAGAACTATCCCAATGTCCTGGCCTTCAGCTTCTTAG
ATGAGCTTCAGAGAGAGTTCATAGTCACGTATGACACCAA
GCGGATCAACAGTGCTTTGAGGCCTTTCTCTTTCATTGAG
TTTGATAACTTCATTCGGAAAACCAAGCTGCGTTACAACA
GCCCACGTTCGCTCTCTACCAAGATTAATCTGGCCGACAT
GCAGACCGAGATCAAGCTCCGGCCTCCTTATCAGCTCTCG
GCGGAGGACATTGGATCAATCAACGGCTTCTCACAACACA
AGGAGTCTAAATATAAAGGCATAGCTCCTAATCAAATGTT
GGAGGCTGTCACCCTGTCGGGTATTGTCGCCTGTGTCCTA
AGCATCCTGTGTGGCGCTCTTAATTTACTGCGGGGAGTCC
ATGCGATTGAAAGCGTATTGCAGAACGACGATGAAGACTT
TAATTACGTAATTGCTTTTTTCCTTGGAACCGCAGCGTGT
TTGTATCAGTGTTACTTATTCGCCTACTTCTCAGTCTGGA
GAAACATCAAGTCATTCCTGGCCTTCGCTCTGATCTGCCT
GTGTAATATGTATCTGTATGAACTCCGTAACCTGTGGCAG
ATCCTCTTTCACGTGACAGTGGGAGCGTTCATCACTCTGC
AGATCCACCTGAGACGACCGCAGGGCAAAGCACCTGACTA
TAATGTTTGACCCCCTTGAACTCTTCAAGACTGTGTAATA
TAGCCCAACATGGCAACTATGAATCTCTTCCTGGCCCGTT
TGAGGACATGCAGTATGGATTTTAAAAGGTTTACAAACGG
TTTTGAAAAATGTCCTGCTGTTTCACATTTAGCTACTGTT
CTGGTTAAAGCAGAAGGTTCATGAAGTTGATTTCATAAAA
GCATTCATTCATTCATGCATACATATTTTTTATTATTATT
GTTAGATGATTCTGATGTGCACAATACATTTTCCAATAAG
GAGTTTTATTATTGATATCATATTTAAAGAGGCAGCTCAT
CTAAAAATGAAAATATTGTGTTCTTGAATAAAGTTTATGT
GGCTTTTTTCCATAAAATGAGTGATGACCATGGTCAGTCA
AAGATAATTATTAAATAAATAAATAAATAAATAAAGTATG
CAATTTTTTTCCATACATTGATACACATTTTGCAGTAGGT
GTAAAATGTTCTTGTATAAAAATCCAAAATCAAACAAAAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations