ZFIN ID: ZDB-TSCRIPT-090929-8977
Transcript Name: atp5s-202
Previous Name: atp5s-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000026294 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000026294|OTTDARG00000020875|ZDB-GENE-040426-959 atp5s|OTTDARP00000021586 atp5s-001 LG_none BX927407.11,BX936452.24 Danio rerio protein_coding KNOWN, 938 bp
GCAGGTGAAAGAGCGAGCGCGCATGGAGGACGCAGGATGT
AAATAACGAACCCGTCAGAACTGCAACAAGCCGAACAGCA
GGCCATAAATATGAGATTGTTCACCTGGTCAGCGCGGAGG
ATTTTATCCGCTCATAAGCAGCCGTCAGGGGGCAGACGAG
AGTTCTGGGGCTGGCTGAATGCTGTTTTCAACAATTGATT
ATGAGCGTATTAAAGCAGTAGGTCCTGATCGAGCTGCTGC
CGAGTGGCTCCTGAGGTGCGGTGCTAAAGTTCGCTTCCGT
GGTTTCGACCGCTGGCAGCACGACTACAACGGACTCCCAA
CGGGGCCACTGGGCAGATACCGGATTGAAGCTATTGATGC
CACAGAGTCCTGTATCATGTACCGAGGGTTTGATCATCTG
GAGGGTCTGGAGCATGTTGAGGAGATCAGGTTGAATAAGT
GTATTTATATAGAAGACGCCTGCCTGGAGCGTTTGGGTCA
GATAAAGACGCTGCAGGACACTGTAAAGCAGATGACAGTA
GTTTCCTGTGGCAACGTGACAGATAAAGGACTCATCGCCC
TTCATCACCTCGGGAAGCTGGAGAGGCTGTTTCTCAGTGA
TCTCCCTGGTGTAAAAGATAAAGATCAGACTGTGGACAGA
CTCCAGGCTGCACTTCCCAGACTCACCATAGAGCTAGATC
TCGCTTAACCAATCACAGCACATTTGGAAAACCACAACTC
TCACAGCCATACGAGCAGAGGCAAACCCTCTGGCTGATGT
CCATCACTACTTCGGCAACAGTATCCAGGCAACTGAGCAT
CACAGGGCAGGATGCAGAAAATCAAAGAACCGGCATCCCA
TCTGATTAGCTTTTGATTACATTTTGTCAGACTACCCGAG
GCAGTTGAACGATGTTATTTTGCCATTATCAATAAATTTC
CAGCTGTTTCCTCACACA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
atp5s-202 Contained in:

Genome Resources: Vega_Trans:OTTDART00000026294 (1),  Ensembl_Trans:ENSDART00000136030 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:BC046029 (1) 931 nt
GenBank:EB798499 (1) 391 nt
CITATIONS (2)