Transcript

ntd5-201

ID
ZDB-TSCRIPT-090929-8973
Name
ntd5-201
Previous Names
  • ntd5-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000026290 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000026290|OTTDARG00000020873|ZDB-GENE-031030-7 ntd5|OTTDARP00000021583 ntd5-001 LG_ BX323458.7 Danio rerio protein_coding KNOWN, 1788 bp
CATAACCTCTGCACCGAGAGTCCGGGAAAGATGGAGCGAT
CTCTGCTCGTGGCTTTTGTGTGTGTGTGGGCCCTCAGCAG
CCTGTCTGCAGCATCAGAAGATGCAGCGGAGCAGTGCCCA
GAAAGAATACTGGGTAACGAGAGAAGACAGACATGCCCAA
AAAAGTGTCAGCAAGATAAAGACTGCGGCAACAAACGCCA
GTGTCTCTGCGATGGCCAGTGTGGACTCAGCTGTGTGGTC
CCAGGTCGTATGTGTCCGTGGCCTCTACCGCTTGGAAAAC
ATTCTGATATAGTTCTCCTTTCCCCTTCACCCTCTTTCTC
TGCCCTGCTTGAGGTTCGTTGTAAGTCTGGGTACACCTTG
TCAAACGGACTGGACACTACAATACGCCGCTGCCAAGGTG
ACCGGCAATGGAGTGGAGATGAGCCTGTTTGTTCGGCCCC
CCCAGGTGGAGATGTTTCAGCAGGGCCGGGTCTGGTGCCT
GATGTGTCCTGTTCATTGCCTGAAGATGATGATCTGCTCT
CTGTGCAGGGCAGTGCCACCACGGGATCCACTATCAAGTA
CCGATGTGCATCTGGATCTGTGCTGATTGGAAATAGTGAG
AATATCTGTCATGAGAACCAGACGTGGCAATACCCTCACC
CCATCTGTCGCCGTGTGGTTTGTCCTCCTCCTAAGGAGGT
TGCTGATCGTGGACATCTGGTGGCCGTCCAGAGAACTGAA
TATGATGTTGGTGACACTATCTATTACCTGTGCAAAAAGA
CCTTCTTGTTGGATGGACCAAATCAAGTGACGTGTCTACC
TAATGGGACTTGGAGTGCAGAGCCTGCTTGTAGAGCCCGC
TGCCCAGTTCCAGCTCAGCGCAGCAGGGTGATCGTGGGAG
GAGTAAAGCGCTGGCCATATGATCTGACGGATGGTGTGGT
TGCTCATGGAGAGAATGTGACATTTTTCTGTAAACATCCA
GAAAAACTGTGCAGCTTTACTGCCACTGAGGTCTGCGTAG
ATGGGGAGTTAAAGGCACCTAGCTGCTACCTTGATCCTAC
CTGGCTGCAGTTCAAGCTTTACCCTCATCGACTGGTTTCT
GAGATTGACGCATGTGATCGTGCAGATCTTCAGTGATCTC
ATCAAAATATGTTCATATTGGCACATGACTCTCAATCTGA
CTCAAGTCTGGTTTAACATAAATTGTCTTAATGTGCCAAC
TACTTTTTGATTTTCCGGACAGGATCTCAGCAGGATCTCA
CATGCGTGCCTCGTCTAACTCTTATGTCTTCTATTTGATT
TTTTTCTATTGTTGCTTTGACAAAGTTACCTTAAACAGAG
TTTATGTCATATCTGATGTATGCAAACACCCTCATACTTG
CTGGAGGTTGTGGATGCTATTAGCTGCTCCCTTGTTATGT
CGTCGTACAAAGTGTAAAACTGCTTTAGAAGTAACTCTGG
CGTTTATCTTATTATATTTCTGTGTTAAAAGTGTTTTAGC
TGATACATTCGTCAGTCACACAAGTGCTTCCAGGCTCCAA
AATTGTGCCATGTTGTGATTCTTTCTAGATTTACTTCATT
CCAAAAGCAGTTTTATGAAATATATAGCATTAACTGAACT
TTGACTGAACTGTTTGACTGGATTACATGAAGAGTAGAGT
TGATCTGTGTGTATTATAGCATAAAAAGCCTTGCTGAAGC
AGCTTTGCTGAATGATTGCTTTCATAAAGGATTTTTTGAA
TGTATTTTCCTCTCCATATCTTATAAATCTACAATAAAGA
AACTGGAACATGTGTGTTGTCATTAAAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations