ZFIN ID: ZDB-TSCRIPT-090929-886
Transcript Name: unc93a-201
Previous Names: unc93a-001, si:dkey-14a7.1-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000006968 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000006968|OTTDARG00000006322|ZDB-GENE-041014-304 unc93a|OTTDARP00000006201 unc93a-001 LG_ AL928920.5 Danio rerio protein_coding KNOWN, 1523 bp
GGAATTTCTCCCTTTGGAAGCATTTACAGGATTTCACGAT
GAAAAAAATTATGAGCCGAAACACCAAAAATGTCTTGGTG
GTTTCTTTTGGATTTTTGTTATTATTCACAGCATATGGAG
GGCTGCAAAGTTTACAGAGCAGTCTCAATGCTGAGGAAGG
AATGGGTGTGATTTCGCTCAGTGTCATCTATGCAGCCATC
ATTCTGTCCTCGATGTTTCTGCCACCAATTATGATTAAAA
ATCTGGGCTGTAAATGGACCATTGTCGTTTCTATGGGTTG
TTACGTGGCGTATTCCTTTGGAAACCTAGCGCCAGGCTGG
GCAAGTCTGATGTCCACCTCTGCCATCCTGGGAATGGGAG
GTTCACCGCTGTGGTCTGCAAAATGCACTTATCTTACAAT
AAGTGGAAACAGGCAAGGCCAGAAACACAACAAAAAAGGC
CAGGATCTCATCAACCAATATTTTGGAATCTTTTTCTTCA
TCTTTCAGTCTTCTGGAGTATGGGGAAACCTCATGTCATC
TCTGATATTTGGCCAGGACCAAAATATAGTTGAAGTCCCC
AAGGAGAACCTGGAGTTCTGCGGTGTGTCAACATGCCTGG
ACAATTTCACTGTCATTGGAAACTCAACCCGTCCATCAAA
ACACCTTGTCGATACACTACTAGGCTGTTACATCGGTGTG
GGGCTTCTGGCCATTATTTTCGTGGCGGTGTTCCTGGACA
ATATAGATCGAGATGAGGCTAAAGAGTTTCGCAGCACTAA
GGGCAACAAATCCTTTTGGGACACCTTTCTGGCCACCTTC
AAGCTCCTGAGAGACCCCAGATTGTTGCTGCTCATCCCGT
TGACCATGTACAGTGGATTTGAGCAAAGTTTTCTTTCTGG
TGAATACACAAAGAACTACGTGACTTGTGCGTTAGGAATA
CATAACGTTGGTTTCGTGATGATCTGCTTTGCAGCTTCAA
ACTCTCTGTGTTCATTTGCGTTTGGGAGACTGGCTCAGTA
CACTGGAAGAATTGCCCTCTTCTGCTTGGCTGCAGCAATA
AACCTGGGCTCTTTTCTGGGTCTTTTGTACTGGAAGCCTC
ATCCAGACCAGCTGGCCATCTTCTTCGTGTTTCCGGCCCT
CTGGGGAATGGCAGACGCTGTGTGGCAAACACAAACCAAT
GCACTTTATGGCATCCTCTTTGCTAAGAATAAAGAAGCAG
CTTTCGCCAACTATCGCATGTGGGAGTCACTGGGTTTCGT
CATAGCATTTGCTTACAGCACATTCATCTGCCTGTCCACC
AAGATCTACATAGCTTTGGCAGTTCTGGCTCTTACTATGG
TAACTTACCTTTACGTGGAGTACAACGAGTACAAGCATCC
GACTCCACAAGTTACTGAGGACTTCCTCAAACCAATCAAG
CCCAAGCTGAAAGACGACAAAGAAGACAATATTATTTCCC
AGACGCAACTGTAAATATATTTCTAGATGATATTTCTGCC
TCAGTATATACAGCTGAAGTCAAAATGATTAGCCCTCCTT
GGA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
unc93a-201 Contained in:
[BAC] DKEY-14A7 (1) (order this)

Genome Resources: Vega_Trans:OTTDART00000006968 (1),  Ensembl_Trans:ENSDART00000142486 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:BC171433 (1) 1523 nt
GenBank:AL919512 (1) 346 nt
CITATIONS (2)