Transcript

unc93a-201

ID
ZDB-TSCRIPT-090929-886
Name
unc93a-201
Previous Names
  • unc93a-001
  • si:dkey-14a7.1-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000006968 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000006968|OTTDARG00000006322|ZDB-GENE-041014-304 unc93a|OTTDARP00000006201 unc93a-001 LG_ AL928920.5 Danio rerio protein_coding KNOWN, 1523 bp
GGAATTTCTCCCTTTGGAAGCATTTACAGGATTTCACGAT
GAAAAAAATTATGAGCCGAAACACCAAAAATGTCTTGGTG
GTTTCTTTTGGATTTTTGTTATTATTCACAGCATATGGAG
GGCTGCAAAGTTTACAGAGCAGTCTCAATGCTGAGGAAGG
AATGGGTGTGATTTCGCTCAGTGTCATCTATGCAGCCATC
ATTCTGTCCTCGATGTTTCTGCCACCAATTATGATTAAAA
ATCTGGGCTGTAAATGGACCATTGTCGTTTCTATGGGTTG
TTACGTGGCGTATTCCTTTGGAAACCTAGCGCCAGGCTGG
GCAAGTCTGATGTCCACCTCTGCCATCCTGGGAATGGGAG
GTTCACCGCTGTGGTCTGCAAAATGCACTTATCTTACAAT
AAGTGGAAACAGGCAAGGCCAGAAACACAACAAAAAAGGC
CAGGATCTCATCAACCAATATTTTGGAATCTTTTTCTTCA
TCTTTCAGTCTTCTGGAGTATGGGGAAACCTCATGTCATC
TCTGATATTTGGCCAGGACCAAAATATAGTTGAAGTCCCC
AAGGAGAACCTGGAGTTCTGCGGTGTGTCAACATGCCTGG
ACAATTTCACTGTCATTGGAAACTCAACCCGTCCATCAAA
ACACCTTGTCGATACACTACTAGGCTGTTACATCGGTGTG
GGGCTTCTGGCCATTATTTTCGTGGCGGTGTTCCTGGACA
ATATAGATCGAGATGAGGCTAAAGAGTTTCGCAGCACTAA
GGGCAACAAATCCTTTTGGGACACCTTTCTGGCCACCTTC
AAGCTCCTGAGAGACCCCAGATTGTTGCTGCTCATCCCGT
TGACCATGTACAGTGGATTTGAGCAAAGTTTTCTTTCTGG
TGAATACACAAAGAACTACGTGACTTGTGCGTTAGGAATA
CATAACGTTGGTTTCGTGATGATCTGCTTTGCAGCTTCAA
ACTCTCTGTGTTCATTTGCGTTTGGGAGACTGGCTCAGTA
CACTGGAAGAATTGCCCTCTTCTGCTTGGCTGCAGCAATA
AACCTGGGCTCTTTTCTGGGTCTTTTGTACTGGAAGCCTC
ATCCAGACCAGCTGGCCATCTTCTTCGTGTTTCCGGCCCT
CTGGGGAATGGCAGACGCTGTGTGGCAAACACAAACCAAT
GCACTTTATGGCATCCTCTTTGCTAAGAATAAAGAAGCAG
CTTTCGCCAACTATCGCATGTGGGAGTCACTGGGTTTCGT
CATAGCATTTGCTTACAGCACATTCATCTGCCTGTCCACC
AAGATCTACATAGCTTTGGCAGTTCTGGCTCTTACTATGG
TAACTTACCTTTACGTGGAGTACAACGAGTACAAGCATCC
GACTCCACAAGTTACTGAGGACTTCCTCAAACCAATCAAG
CCCAAGCTGAAAGACGACAAAGAAGACAATATTATTTCCC
AGACGCAACTGTAAATATATTTCTAGATGATATTTCTGCC
TCAGTATATACAGCTGAAGTCAAAATGATTAGCCCTCCTT
GGA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations