ZFIN ID: ZDB-TSCRIPT-090929-877
Transcript Name: mcm9-201
Previous Name: mcm9-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000006931 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000006931|OTTDARG00000006286|ZDB-GENE-041014-310 mcm9|OTTDARP00000006167 mcm9-001 LG_ AL845301.15 Danio rerio protein_coding KNOWN, 4126 bp
TTCGTATCTAATACTTTACATAGTTTAGAAGGAGTTATCT
TATACTGTAATTCAGAGTTTGTCTACAAGGCTTCCCCATA
CAATACCGGAAGATTCTGAATATAGCGCCAAATCTGAAAA
CACGGACAGGAAGAGGAGGAGGAACCCACATGTTGATGTT
ATTAATGTAGATAAATAGCTACTGCTCGTCCAAACAGAAG
TCTTCATGAACTCTCGGTGATCGTCTTCAGATGACCATGA
TGCTCAGTCCAGATCAAGTGTCTTTGATCGGACTGGTGTT
TGAGACGTACGTGATGGAGCACCACAAGAGCGACATTCAG
CAGATCCTCCAGGAAAACACAGAAGACCTTCACTATCCTG
TAGTCGTCAATGCCATGACATTATTCGAGGATAACATGGA
GGTCGGAGAGTGTTTCAATGCTTTTCCCAGTAAGGTGCTG
CCCATATTTGACAACGCCCTACAGAGAGCAGCGCAGGCCA
TATCTCAGTCCTCCTCTTCATCACCGCAGGACACTTTCAG
GCTCAAACACAACATGCATGTTCGGATTTCAGGTTTACCT
GTGTGTCCCGAGCTGACTAGAGATCATATTCCTAAAGCCA
GAGACGTGGGCCATTTCCTGTCTGTCACGGGCACTGTCAT
CCGCACCAGTGTAACCAAAGTACTGGAGTATGAGCGAGAC
TACATGTGCAATAAGTGCAGACACGTGTTCTCCGTGCAGG
CCTCCTTTGAGCAGTTTTACACCTTCACTCCACCGACCAG
CTGCCCCAGTGAGGAGGGATGTGGTTCTTTTAAATTTACC
TGCCTATCTGGGAGTGATGCCCCACCGGCCGCCTGCAAGG
ACTACCAGGAGATCAAAATTCAGGAGCAGGTACAGAAGCT
GTCGGTGGGCAGCATTCCTCGATCCATGCTCATCATCCTG
GAGGATGATCTTGTGGACAGCTGCAAATCAGGAGATGACA
TCACAGTGTACGGAGTTGTGTGTCAGCGCTGGAAGCCGAT
GTTTCAGGACTGCCGCTGCGATGTGGAGATCGTGCTGAAA
GCAAACTATATAGAGGTCAATAATGAGCAGTCCACTACAG
CACTGGTGCTGGAAGACATTCAGAAGGAGTTTGAGGAATT
CTGGGACAGTCACAAACATGACCCCATTGCCGGCAGGAAT
GAAATCTTGATGAGTCTGTGCCCTCAGGTGTTCGGCATGT
ACGTCGTCAAGCTGGCTGTTGCTATGGTTTTGGCAGGTGG
TGTGCAGAGAATAGATGCATCTGGAACCAAGGTGAGAGGA
GAGTCTCATCTGTTGCTGGTGGGTGATCCAGGCACTGGGA
AGTCACAGTTTCTGAAGTACGCTGCTAAGATTACACCACG
GTCTGTGCTCACGGCAGGAATCGGATCAACTAATGCAGGT
TTGACGGTGGCGGCTGTGAAGGACTCTGGAGAGTGGCATC
TGGAGGCTGGAGCTCTGGTTCTGTCTGATGGAGGCCTGTG
CTGCATTGATGAGTTCAACAGCATCAAAGAGCACGACCGC
ACCAGCATCCATGAGGCCATGGAGCAGCAGACTATCAGCG
TGGCCAAAGCCGGAATGGTGTGCAAATTAGACACAAGAAC
CACCATCCTAGCGGCTACTAACCCAAAGGGCCAGTATGAC
CCTAATGTGTCTGTGTCTGTGAACGTGGCTCTCGCCAGCC
CCCTGCTGAGCCGCTTCGACCTCGTCCTGGTTCTGCTGGA
TACAAAAAACCCAGACTGGGACAAAATCATCTCCTCCTTC
ATCCTGCAGAATAAAGGAGCGCCGAGCGAGTCTTTGTGTT
TATGGAGCATGGAGAAGATGAGGGCCTATTTCTGCCTCAT
CAAGACTCTTAAGCCTCGTATAACACCGGAAGCAAACACT
ATCCTGAGCCGCTACTATCAGCTGCAGAGACAGAGTGACA
GTCGAAACGCTGCCCGAACAACCATACGCATGCTGGAGAG
TCTCAGCCGCCTCGCTGAGGCTCATGCTAGGCTGATGTTT
AGAGAGACTGTAACAGTAGAGGATGCTGTTGTGGTAGTGT
CTGTAATGGAGTGCTCCATGCAGGGAGGCGCTCTGCTGGG
AAATGTGAATGCTCTGCACACCTCTTTTCCTGATGAGCCC
TGTGAACAGTATAAAACACAGTGTGAGATTGTACTGGAGA
GGCTGGGACTCTCTGATCTCCTACAGAGGGAACTACAGAG
ACTCTCAGGGCTGCAGAATGGTAGACCAGGATCCCCTAAA
AGTCCTCAATCACATAGTGAACACAGAAATGAAAACACAA
CCAGTACAAATCACAGTAACCAAGAACTCGGCCTGAACTG
GTTCCACTCCTTATCCAGCTCATCCAACATCACCTCCAAC
AATCCTCCAACACCAGTCATTACCTCAACACAGAACGCCA
CCACACCACCAGATATGACGAGCAGAAACCAACAGCAGCA
GGCTTCGGTGTGGGCGAAAAGCGCAGATGTATCTGTGGAA
GAAGCTGTACAGGAAACAGTCTCCAAAAAGCTCAGAGGCA
AACGACTGAAAGAGATGAAAGAGACCCTCCTGCTGAGCAA
AGACGACGATTTGGAGGACATCTTCTCTCATAGTACACCC
ATGAAAAACTCCAAACGTAAAAACATGGCAGACACTTACC
AGGAGAGTGGAGAGGATCTACACGACAAATTTACAAACTT
CACTTTCAAGCCCAGAGAGAAAATGAGTCACGCTAATGCA
AGCACAAGCACAAGTGCTCCTGAAAAACAGAAGAGGAAGA
TTGAGACAGACTCACATCCTCCAGCAGAGGGCGGTAGAGC
TAATAAAACTCTCCGAATGGAAACCCACAGTAAAAACAAG
ACTTGTATAGAATCTGAAAAGGATGCAATAATCCCTGAAG
CTCCTAAAAAGCAGGGTGTTAAAAAAAACAATTCAAGCTT
ACGTCCTCCAGCAGAGGGCAGTAGAGCTTATAAAATTCTC
CGAATGGAAACTCAGAATACAAACTTGACACCTATAGAAT
CAGTAAGAGATTCAATGAAGCCTGAAGCTCCTAAAAAACA
GGACGTCAAGAAAAATGAGTCAATCTTATGTCCTCCAGCT
GAGGGCAGTAGAGCTGATAAAACTCTCCGAATGGAAATGT
ATAATACACCCAAAGATGTTTCCTCACAGCTCTTGAATGA
TGACAGTTCAGCTCAGAAACAGATGTTTGAGGATAAAGAA
CATCCCCAACAGCTGCTGTCGAGACTGAATGCTCTTTCTC
CAGGTGAGAACGACGACGGCTCTAATAAAAAGCCACTAAA
GACGGACCACCCAAAGGCTAAAGTCGCCAGCTCGACTCTG
GCCAAACTTTCCAGGTTTTCCTTTACGGGCTCATCTGAGG
AGCAGGCTGGACATAAAACAGTGCAGACTCCACCGGTGGC
CGCAAATGGCGGTGTTAATGTTGTGGCAACAGGTTCTGAA
AAACAGGAAAACATGACAAATATGAGTATGAGGAGAGAGA
TCTCTGACAGGCAGGAGGATGATGGAGAAACCGCTGGAAG
GAAGAGGAGGTGTTTTGAACTGGGCTCTGGAGGATCTGCT
GGACTCATTAAAGGGTTTTCACTGTTCAGCTCGTCTGTCT
TAGATGATGAAGATTTTGATGATGTCTGGAACTGGTAAAG
CGAGATGTGGTTGTTGTGCAATAGCATTATATTTCTATTT
TTAATGTTTGTTTGTTTGTTTGTTTTTGAAAACGTGATGT
TTTAATTACCGCAAAACAATATGTCACATATATCAGATGA
GATCTGACGTCACAATAATGGCAGTGTAAAGAAGCTATGT
GCACTTTTTCTTTTGTTTCAGTAAATTTCAGTTATGTTTT
TATTTCTGGTTTCAGTTGTTTGTTTTTACAAATTTGAATA
TCTCCATTTGTTTTAATGTGGTTAAATCGAAATGTTTATT
CTTTAATGTAATCGTCATTAAAAAAAAAAAAAAAAAAAAA
CTTTTTTGATTTGCCCAAATTTTAAACAGTCGTCAAATCG
TGAGGAGTACTGCACTAAAGCAAAATAAGAGATTGAGCTG
GTATTTTCACGCTGCCCTGGCTGAACCCGTTTACACCAAT
ACGTTTTAGTTTTACAACAGTGTTTTAGAATGAAAACGAT
CCACAC

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
mcm9-201 Contained in:
[BAC] CH211-112M17 (1)

Genome Resources: Vega_Trans:OTTDART00000006931 (1),  Ensembl_Trans:ENSDART00000139805 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:BM036802 (1) 600 nt
GenBank:CB360563 (1) 587 nt
GenBank:BG799650 (1) 528 nt
GenBank:BM037096 (1) 383 nt
CITATIONS (2)