ZFIN ID: ZDB-TSCRIPT-090929-8764
Transcript Name: ap3m1-203
Previous Name: ap3m1-002

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000026071 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000026071|OTTDARG00000023545|ZDB-GENE-021015-2 ap3m1|OTTDARP00000021416 ap3m1-002 LG_ CR788251.13 Danio rerio protein_coding KNOWN, 602 bp
ACTACAGAGTGTCATAGCTGTCCCTGTGTTTTGCCAGAAC
AGAGAAATACATTCCTGTTATAAATTAAGCGTAGATTTGG
ACGCATCGACTGGGAAGGAGGAGTGACACATCTGCCACAT
TTGCAAGAGGGGGATATCGCATGAAAACATTGATCAAGAC
AGCTGTCTGCAGCGCTCATCATGATTCACAGCCTGTTCTT
GATAAACAATGTTGGTGATTTATTCCTGGAGAAACACTGG
AAGAGTGTCATAAGCCGCTCCGTCTGCGATTATTTCTTCG
AAGCACGAGAGAAGGCAGGGGAACCGGACAATGTGCCTCC
TGTCATCCGCACCCCTCATCACTATCTCATAAATATATAC
CGTGACAAGATCTTCTTCGTCTCCGTCATCCAAACGGAAG
TGCCTCCGCTGTTTGTAATAGAATTTCTCCATCGGGTTGC
AGAGACTTTTCAGGATTATTTTGGAGAATGTTCTGAGACG
ACTATAAAAGAAAATATGGTAATAGTCTATGAGCTCCTAG
AGGAAATGCTGGATAACGGTTTCCCCCTTGCCACAGAATC
TAACATCTTAAAAGAGCTCATCAGACCTCCTAATATCCTG
CG

ap3m1 TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA ap3m1-201 (1)    Ensembl 2115
ap3m1-203 602
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
ap3m1-203 Contained in:

Genome Resources: Vega_Trans:OTTDART00000026071 (1),  Ensembl_Trans:ENSDART00000139209 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:CK692019 (1) 607 bp
CITATIONS (2)