Transcript

fam184a-202

ID
ZDB-TSCRIPT-090929-876
Name
fam184a-202
Previous Names
  • fam184a-002
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNACentral
Note
None
Sequence
OTTDART00000006930 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000006930|OTTDARG00000006285|ZDB-GENE-041014-214 fam184a|OTTDARP00000006166 fam184a-002 LG_none AL928827.10,BX649543.6,AL845322.7,AL845301.15 Danio rerio protein_coding KNOWN, 3111 bp
GTGATCTACGCCCTAAACACTAAGAACGATGAGCACGAAG
CAGCCATCCAGACCCTGAAGGAGGCCCACGAGGAGGAGGT
GCAGCAGATCCTCTCAGAAACGCGGGAGAAGATCATGCAG
TACAAGAGCAAGATCAGCGACGAGATGGACCTGAAGCGGC
GCATTCAGTCTCTGGAGGAGTCAATGGAGCTTCATGAGCG
GATGAAGCGGCAGGCCTTGGACGAGTTCGAAACATACCGT
CAACGGGTGGAAGACATGCAACTGTGCACAGAGGCGCAGC
ACACACAGCGCGTGGTAAGCATGTCCCGTGAGGTGGAGGA
AATGCGACGCTCATTCGAGGAGAAGCTCAGATCCTTTGCA
CAGTTGCAGTCTCAGTTCGAGCAGGAGAAACGACAGGCTC
TGGAGGAGCTGCGCAGCGGACATCGGCAAGAGGTTCAGGA
ACTGCTTCGTTCACACCAAAGCCAGAATGCAAACTACAGC
AAAGACCAGGAGAAACTGGGCCAGCTTCACAAAGCCGAGG
TGGATTCGCTGAACGAGCGGGTGGAGGAATTGAAACAGGA
CAAGAAGCGTCTGGTGGAGGAGTACGAGGCCAAGCTAAAT
AAAGCCCAGGCTTTCTACGAGCGCGAGCTGGAGGCCATGA
AGCGCACGCAGCAGATGACGGCCGAGAACCTGCTGGCCTG
GAAGAAGACCGAGGCTGAGCTTCGCAAAGAGTTCCAGGCG
CAGGAGGCGGCGTTGCAGAAAACTCTGGGGAAGCTGCGCA
GCGAACTACAGCGCGTGCAGGACGAGGCCAGAGAGAGCAG
GGAGAAATCCCACAAACTACAGGCCTCCCTCATGACTGCT
GAGAACAACATAAAGGAGCTGCATAAACAGTTGGAGGAGG
TGACTAAGGACGCAGAGATCGTGGAGATCAGGCAGAGGGA
GGGCGAATGTGAGCTGGAGGCTTCCAGAGACAGAGTGCAA
CAGCAGGCCACAGAGATCCTGCTCAAAGCCAGTCAGATCG
GGAGTCTTCAGGCCACTCAGATGACCCATGAGGCCGTCAT
TCGGGACCTGGAGTCGGAAAAGTCTCGTCTGAAGGACAAG
GTGTTGCGTCTGGAGGAGGAGAGAGGAGCGCTGCAGAACA
AATGTCAGACGCTGGACGACCGGCAGAGACAGCAGATCGT
CACACTGGAGAAGTCTCTTCGAGAGGAAAAGCAGATCTAT
GAAAAGGAGCTAATGAACTTGCGTGCCAAATATGAAGACG
ACACTGCTCACTTTAAGGAGAGCCACAGCCGGGCGCTGGA
GGAGCTCTCCAGAAAACACCGGGCATCCCTGGAAAACATC
CAGAGCCTCTCGGAGAAGGAAAAGAACCGGCTCCTGTCTG
ATATGGAGGATCAGTTCAACAAGGAGCGGACCTCTCTAGA
AGAACAGAAGAGAATTTTACGTGAGGAACTGGACAGTCTG
AGAGAGGAGCTTACAGCCAAACTCAACATGGCCAACAATG
AGGTGAGTCGGCTCCAAGAGCTGGTGAAGCAGGGTGAGCA
GACACTGGGCTCATCTGAGGGACATATCTCCAACCTGAAG
GACGCTCAGAAGAAGCTTCTAGAAGAGCTGGACGCCACAC
GAGCCAGACTCAGAGAGACCAGCAACCTTCTGACGGCCCT
TCAGGGAGAGATGGAGACTCAGAAACAACAGCACGATGCC
AAACTCATCTCCATCAAAGAGGAGGAGAAGCTCAAAATGG
ATAAGATGGCCCTGGAGCTCGAGCTGAAGTGGACCGAGAC
ACTCAGGCAAGAGTGTAAGAAATTGCGTGAGGAGCTGCGT
GAAGATCATGAAGAGGATAAAAGGTCAGCGCTCACCCAGC
TGGCCCAGAATAAAGATCAGGAGCTCTGCTCGGCCAGAGA
GAGTTGGCAAAGGAAGGTGGAGGATCTCCTGGAGCAGATC
TCGCTGCTGAAGCAGAGTCTGGAGATGCAGCTCTCGCAGT
CGCAGCACTCTCTGCAGCAGCTGCAGGCTCAGTTCAGTCA
GGAGCGGGAACACCTGGGCCAGCAGCTGGAGGAGATGGAG
ATGGAGCACCAGCACAGACAGCAGCGGCTGCAGGAGGCTC
ACTGCTGTGCCATACAGGACATGCAGGAGGCCCGTAAGCA
TGACCTCAAGGCGCTGGAGGAACGTCTGAGGCAGCAGCAC
CACATGGAGCTTCAGACCCTGCGTGAGGCTCACAGGCAGA
ACATCGAGACCCTCAAACAGCAGTCAGAACAAGAGCTGCA
GACCCTCCGCTTCGAGCTGGAGGACGAGGGCAAAGCCATG
CTTGCGTCGCTTCGTTCTGAGCTCAACCATCTCCACGCAT
CAGCCATTGAACACATGCGTCAGACCCATCAACAGGAAAC
AGCAGCTGCCAAACAGGAACTGGAAAACGCTTTGGAGCAG
AGCAGAGTACAGGAACGTGAGCTTCTCAGCCGCATCTCGG
ACCTGCAGGAGGAGGTCAGTCGCAGGAAGAAACACATCGC
TGATTTGGATCATGAGATCCACACGCTCAACGAGAACATC
AGCACTCTGACCAAAGAGCTGGAGCTCAAGGGCAAAGAGG
TGCTGAAGATCCGCAGCGAGGCCAACCAGCAGATCAGGTT
GGAGGGAACAGAAGATAAGTTTCGCAACAGAGAGAGCAGA
CCTGAAGATCTGCAGACGATAGCCGAACTGAAGGACATGG
TGGCCGAAAGAGAGGCTTTGGTCAAGAAGCTGGTGGATGA
CAAAAAGTTTTACCAGCTGGAGCTTGTAAACCGAGAGACC
AGCTTCAACAAAATATTCAACGCAAACCCCAATGTTGGTG
TCATTAACCCTCTTGTCAAGCAAAAGCGAAAGAACGACAA
ATCAGCCACCCGATTCAGCAGCTCGGCCAATCTTAGGGCC
AATGTGGAGGCTTCGGGAACAGGGAGCGGGCAGCCCCAAC
CCAACCGCCTCGAACCCCTTCCCAACTCCCCCATTCACCA
GCTGGAGCCAAACGCGAGCAAACCCTTGTCCCTGCCAACC
CCTCTCACCGAACCCAAGAAAGTGACGAGCCCTCCTGAAG
GAGAAGAATCAGCCTTGACCTCTCCGGACCCCCAGAGACA
AGAGTGGTTCGCTCAGTATTTCTCCTTCTGA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations