Transcript

sf3b5-201

ID
ZDB-TSCRIPT-090929-8749
Name
sf3b5-201
Previous Names
  • sf3b5-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000026054 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000026054|OTTDARG00000002039|ZDB-GENE-040718-181 sf3b5|OTTDARP00000021403 sf3b5-001 LG_ AL772289.10 Danio rerio protein_coding KNOWN, 564 bp
CCGGTCCGGTTGAAGTCACCTCGCACAGCCATTGTGTACA
ATAACTGCTGGGGGAATCATTCATTCGTTTTTCCATAAAA
CATCACAGTTTTTCATTATAGAGGGAGAGGTTTTCTAATC
GAAGATGACAGACCGTTACAACATCCACAGCCAGCTGGAG
CATCTCCAGTCCAAATACATTGGCACGGGCCACGCGGACA
CCAGCAAGTGGGAATGGCTGGTTAACCAGCACAGAGACTC
GTACTGCTCCTACATGGGTCATTTCGACCTTCTCAACTAC
TTCGCCATCTCAGAGAACGAGAGCAAGGCTCGGGTGCGCT
TTAACCTAATGGAAAAGATGCTGCAGCCCTGCGGCCCTCC
AGCTGACAAACCTGAAGATGCCTAGCACACTTTGGCTGAA
TTCATACTGCTGCTGAAGAGATGTGCAGAAAGATCATATG
GACTCATGCTGGTTGTTTAAGAACCAGTCTATGTCTACCT
GTCTGTTTTTTTTAATGCTGTAATTTTTTGTGATATTTTT
TTTTTTGTATTGTTGAAAAAAATAAAGTTGATACTCTTAC
ACAC

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations