header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-872
Transcript Name: pkib-201
Previous Name: pkib-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000006910 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000006910|OTTDARG00000006272|ZDB-GENE-041014-312 pkib|OTTDARP00000006146 pkib-001 LG_none AL845421.9,AL845339.11,AL845365.9 Danio rerio protein_coding KNOWN, 1409 bp
GGTGTCAGAGAGAAGGAGAATCACGACGAAGATGGTCTCG
ATACGCGGAGTTCCCCTCATGGATAGCCTCTGTTGGTACT
GATTTGAGTGTTTCTCCCGGATAACTCTGCTTCGAGGAGT
TACTTCGTATTCGGAATGATGCTATGAAGACCACCAGAGA
TGACTGATGTGGAACCTGTTGTCTCTGACTTTGCAGCCAC
GGGCAGGACTGGCCGGAGGAATGCATTGCCAGACATTCTA
GGTTCCACGGCTGGTCCTGGAGCCGCCGACCTACCTGATA
AACTAGCCGAACTCACAGTAGGAGATGATGGTGAACAGGG
TGGAGAGAGCTCATCCTCAACCGACCCACCCAAAGAATCC
ACAGAGGGGGCAAAGACAGAGGGTTCATAAGTCGACAGCA
TGTCCCGACGCGATCTGACCTCACGATCTGCCTCTATTCT
TGTCCCATTGACCAAACAACTGTTACAGTCTGTGCTATGC
AACATCAAGACCACTGAGGATTGGCATTCAGACATGGCCC
AGCGGGAAAAACAGCTCATTCCCATAACAGGAATCCACCC
GAAGTTGCGTTTTTTTCCCCCAAATAGCAACGATTGTTCA
TTTCATTTTGTACCTCTACAACTTCTTTCCAAAGACTCAC
CAGACTCATGATTTTCCAAACAACCCAGCTGTTTTGTGTG
TTTTATGAAAACAGATGTGACCTGCTTTCCCATTTTAAAA
GAACATTCATTTCATTTGTTTTTAGGACTGCCCCCTTTTG
CATTTTCTCTGAATGTTGACATGTAGTGGCGAAAAAAAAG
ATCTCTTTTTGCACAAAAAAACAACAAACAAAAACAGTAA
ATACATTCCATTTGGTGGCGTTTTTTTAATCTTACGATAA
ATCCGTCTGTCCTTGTACAACAACACTACATCCTCTGTGT
TTTGTATTGTAAAGATATGCATTGTTAACGTTCTAGAGGA
AAAGAATAACAGTGCTGAACTACATGAAATATGATATTTT
CTTCTTGTAAATATACAGAATTGTACATTATATTTGCTAG
TATGTTTAAAAAGCCTTTTGTTGTGTGCGTAAACGCTGTC
AGTGTTGCCCTGTGTGAGCTGAAATTGGATTGTTAGTTGT
CGGATGTATCGCCGCAAAACATCTTGTGGTCATTCGGACA
TGGTTTTTAAGTGCTAGTCTCAGATATTTCTTTGCTGTTG
TTGGTGGCAGTGGAAAAATATGATTGTGGAGACGTGTTCC
TCTTTCATTCCTCTTTTTTTTCATCTTGCTTTTATCAGAG
AAATGCATTTAATTTAATTGTATATTTTTTTTACAAGGCC
ATGAATCTTGTGTCATTAAGTCTGTTATAAGCAACATATA
AAAAACAGTCATGCTGTGTTTAATAATTACAATAAATCTG
TGCTTAGTA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
pkib-201 Contained in:
OTHER pkib-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000006910 (1)
  • Ensembl_Trans:ENSDART00000075092 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:CF348665 (1) 766bp
    GenBank:CK027003 (1) 752bp
    GenBank:BI845352 (1) 567bp
    GenBank:BI846827 (1) 559bp
    GenBank:BG308546 (1) 549bp
    GenBank:BI845673 (1) 430bp
    CITATIONS (2)