ZFIN ID: ZDB-TSCRIPT-090929-871
Transcript Name: fabp7b-201
Previous Name: fabp7b-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000006909 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000006909|OTTDARG00000006271|ZDB-GENE-040614-4 fabp7b|OTTDARP00000006145 fabp7b-001 LG_ AL845421.9 Danio rerio protein_coding KNOWN, 673 bp
AGCTACATTTTTACAAGGCATTGTACATTAAGTTTGTTTA
TCACAGTTTTGATTCAGAAAATGGTGGATGCTTTTTGTGG
CACGTGGAAGCTGGTCAGCAGTGACAACTTTGATGAGTAT
ATGAAATCCCTAGGTATTGGGTTTGCAACAAGACAAGTTG
GAAATGTGACCAAACCGACGCTCGTCATCTCGAAGGAGGG
AGAAAAGGTGGTCATAAAAACACAGAGTACCTTCAAGAAC
ACCGAGATCTCATTCACACTGGGTGAAGAGTTTGAGGAAA
CCACTGCTGATGACCGACACTGCAAATCCACTGTGCTGCT
CAAAGGAAACCAGCTCGTCCATGTGCAAAAGTGGGATGGG
AAAGAGACCACTTTTATCCGAGAGATCAAGGACGGGAAGA
TGGTGATGAAACTCACCTTTGGGGACGTGGAGGCTCTTCG
CACCTATGAAAAAGCATAGGCTTTGGGAATACTATCAGGT
GTCGCTGTTCTTCTTTCTGGCCAGAAACAGACAGTCATGA
TGTGCTCTGAAAGCAAAACCTTGAACTTTATTCATCCAAC
TCATTGAAAGAATGGACTTTAAATATTTTTGTTTTTTAAT
TATTATTATTTTTATTTGTACAATAGCTACATATAGTCTG
CTAGTTTGTATAATAAAGAACCAAAAGAAATTA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
fabp7b-201 Contained in:
OTHER fabp7b-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000006909 (1)
  • Ensembl_Trans:ENSDART00000041229 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:AY380814 (1) 686bp
    CITATIONS (2)