ZFIN ID: ZDB-TSCRIPT-090929-870
Transcript Name: clvs2-201
Previous Names: clvs2-001, si:ch211-199i15.4-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000006908 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000006908|OTTDARG00000006270|ZDB-GENE-041014-313 clvs2|OTTDARP00000006144 clvs2-001 LG_ AL845421.9 Danio rerio protein_coding KNOWN, 1514 bp
GCTTGATGATGGTAGGATAGAGCAGCGCTTTTAACCGTCA
TTGGGGTGGGATGGAGTGAATGAACGGATTTGTAGTCTAG
TCAATGCCTCCGATTTGATCATATACGCAAACTCAGACGA
TTTCCGCCTGCTTAAGCCATACAGACACACACACACAGAC
ACACATATACATATACAATCGATGAGCACGACCAAATGAA
TGTACGTGATGTAATGTTATTAATAAACCTATGATACAGG
TGAACTCATGAGCTGAAGTAACAGTGTCGTAGCTCACACT
CAGGACCATCTCCAAAGTCAGGTTTTTATTTGAAATCACT
GCAGCGATAGGGCTCTTTATGATTGGCATTTTCATCATTA
ACATATAGAGTATATATCTATATATAGTGGTAGTACAGTA
TAGTCAGCATTGGCTCAGTGCAAGGACAATGACTCATTTA
CAGGCAGGCCTGTCTCCAGAAACCCTGGAGAAAGCCAAGG
TGGAGTTAAAGGAGAACCCCGACACTTTGCATCAGGACAT
ACAGGAGGTGAGGGACATGATCATCACCCGTCCAGACATT
GGCTTTCTCAGGACAGACGATGCTTTCATCCTGCGCTTTC
TTAGAGCTCGTAAATTTAACCATTTCGAGGCCTTTCGCCT
CCTGGCCCAATACTTTGAGTACCGGCAACAGAACCTAGAT
ATGTTCAAGAACCTGAAGGCCACCGATCCAGGGATCAAGC
AAGCTCTGAAAGATGGATTTCCTGGAGTCCTTTCCAATCT
GGATAGATATGGGAGGAAGATTCTGGTCCTGTTCGCAGCC
AACTGGGATCAGAGCAGGTACACTTTTGTGGATATTCTGC
GAGCTATTTTACTTTCTCTGGAGGCAATGATAGAAGACCC
GGAGCTACAAGTTAATGGATTTGTCTTGATCATTGACTGG
AGTAACTTCACTTTCAAGCAAGCTTCCAAGCTCACTCCAA
GCATGTTGAGATTGGCAATCGAGGGCCTGCAGGATAGCTT
CCCAGCCAGGTTTGGAGGGATTCATTTTGTCAACCAACCT
TGGTACATCCACGCTTTGTACACAGTCATCCGACCTTTTC
TCAAGGACAAAACAAGAAAAAGGATTTTCATGCATGGAAA
CAATCTGAACAGCTTGCACCAGCTGATCTTGCCTGAGATT
CTGCCGTCTGAACTGGGTGGCATGTTGCCTCCGTACGACA
TGGGCACATGGGCCAGAACGCTGCTTGACCACGCATACGA
CGAGGAGACGGACTACTGCCCCGAATCCTACACCCTTTCT
GTTAAAGACCTGGAGAAAGACCTGTCGCCCAAAACCATGA
AGAGGTCCCAGTCCGTGGTGGAGCCAGGTGTCCTGAAACG
ACCAGAGAAAGTGAAAAGTGAAGAAGAGAACATGCAGCCG
CTGCTTTCGCTGGACTAAAGCTTCTTAATTCCCCAGGCAA
TGAGGAACCATTCCACCCCGTCTGCTGGGAAGGAGTGCAC
CTTGTTCCTGTAACACACAAAAACACGAAAAAAA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
clvs2-201 Contained in:
OTHER clvs2-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000006908 (1)
  • Ensembl_Trans:ENSDART00000075112 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BC116475 (1) 1512bp
    GenBank:CK397933 (1) 867bp
    GenBank:AL714841 (1) 265bp
    CITATIONS (2)