Transcript

slc25a5-201

ID
ZDB-TSCRIPT-090929-8685
Name
slc25a5-201
Previous Names
  • slc25a5-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000025986 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000025986|OTTDARG00000020697|ZDB-GENE-020419-9 slc25a5|OTTDARP00000021348 slc25a5-001 LG_ AL590151.8 Danio rerio protein_coding KNOWN, 1335 bp
CTCGCGAGACGAACCTTTTAAAAACGTCGTCTCAACTTTT
CAATCGGCCATTTCGAATCAGCCGGCATTCCACGCTAGTC
CTGCGGCAGAGCGGGATTGACCTCTTCAAGCGACACCTCT
CCAAGAACATCCAACAATGAGTGAGACCGCCATCTCCTTC
GCCAAGGACTTCTTGGCCGGTGGTATTGCCGCTGCCATCT
CTAAAACCGCCGTGGCCCCCATTGAGAGAGTCAAACTGCT
GCTTCAGGTGCAACATGCTAGCAAACAGATTACAGCAGAT
AAGCAGTACAAGGGCATTATGGACTGCGTGGTGCGTATCC
CCAAGGAGCAGGGCTTCCTGTCGTTCTGGAGAGGAAACTT
GGCCAACGTCATCAGATACTTCCCCACACAGGCCCTCAAC
TTTGCTTTCAAGGACAAGTACAAGAAGGTCTTCCTTGATG
GTGTGGACAAGCGCACCCAGTTTTGGAGGTACTTCGCTGG
TAACCTGGCTTCAGGTGGTGCTGCTGGTGCCACATCCCTC
TGCTTCGTGTATCCCCTTGACTTCGCAAGAACCCGTCTTG
CTGCCGATGTCGGAAAGGCTGGAGCAGAAAGAGAGTTCAG
TGGGCTGGGTAACTGCTTGGTAAAGATCTCCAAATCTGAT
GGCATCAAGGGTCTGTACCAGGGCTTCAACGTGTCCGTGC
AGGGTATCATCATTTACAGAGCTGCCTACTTCGGCATTTA
TGACACAGCCAAGGGTATGCTGCCCGATCCCAAGAACACC
CATATTGTTGTGAGCTGGATGATTGCTCAGAGTGTGACTG
CTGTTGCTGGTCTTGCTTCCTACCCCTTCGACACAGTGCG
TCGTCGTATGATGATGCAGTCTGGACGTAAAGGAGCCGAC
ATCATGTACAGTGGCACAATTGACTGCTGGAGGAAGATCG
CACGTGATGAGGGTGGCAAGGCTTTCTTCAAGGGAGCCTG
GTCCAACGTTCTCAGAGGCATGGGTGGCGCCTTTGTGCTG
GTCTTGTATGATGAGCTGAAGAAGGTCATTTAAATGTTTT
CCTGTCCACCATTCAATGTGAGATGTTTAACTGTAACATA
TCTTGTACATTTGGAAGGACTCTCAAATTCCGCCTTATTT
ATAGGGACCAACTAGTATGTCAGTACTAGTTGTACTGGGG
GAAATTTGTTTTGCGGTTTTTCTTTTGCCCCGTTCATCTC
TCCTTTTTGTTCCCCTCACCGTACTGTCATTCCCAGAAAG
AAAGAACAAAAGAATGCCAGGTACTAAAATCTACCTGTTT
TCCAGCCGGTCTGTTTTTAGTCTTCATCAATAAAGACCCA
CTGAATGAACCTACA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations