header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-8580
Transcript Name: perp-201
Previous Name: perp-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000025874 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000025874|OTTDARG00000020626|ZDB-GENE-050104-1 perp|OTTDARP00000021260 perp-001 LG_ BX323887.10 Danio rerio protein_coding KNOWN, 3265 bp
TTAACACTCGACCAGAACACACGCTTTACACTCTATCAGA
AGCATAATGTTCCGGTGTGGGATCGACTACACGCGGTGTC
GGTGGATCTTGCCGATGCTGCTGCTGTTCGCCATTATATT
CGACATTATCGCGATCGCGGCGCAGTCCGGCTGGGTGGAG
GATCAGGACGCTAAAACACACTACGCCAGCATGTGGAAGC
AGTGCCGAGGCCGCAACGACCAGTGGGACTGCAAATCCCT
CATGGAGTTCTCTTGGGCTCAGGCTGTAGCTGCTCTGATG
ATCATCGGCCTCATCATCCTCATCTTCGCCTTCATCATCT
CATTAGTGGCACTGTGCTCTACCGTCAACGTCTCTCTGCT
GCCCTTCATCGGACTACTCCTCATCCTGGCTGTAATCGTG
CAGATCATCGCTCTGATCATCTACCCGGTCAAGTTTAACG
AGCAGATCTACGAGGGTTATTACGACTACACGTGGGCTTA
CGGTTTCGGCTGGGGCGCCACAATCCTGACGCTGGGCTGC
GCGATCCTCTTCTGCTGCCTGCCCCGCTACGAGAGCGAGA
TCACCGGCCTTGAAAAGACCAAATACATCTACCAGTCTGG
CTAAGAGAAAAACACACACAACACACCTGAGAAAGGACAG
TCTCACACACCACTCCAGCATGAGGAACACTGAGAGAGCA
CCAGCATTAACTAAAAACACACACAAAACGGCGTCTGTGC
TGAGAAAATGGCCTTTTTGACTCACTTTTGCTGCAGTTAT
GCTTCATTTTAAGTCATTTTATTGTTTTTCATGTTTTTTT
TTCATTTAAAGGGATTGCACACCCCAAATCTTTGGGTGAA
CTGTCCCTTTAACAGGTATACATGCATCTCTCCCATAGTT
AATTCTGATATGTGGAAATATATGCAAATAACTTCTATAA
TATACAAGAAAATAGGCCTTTTTGACTCACTTTTGGCGCA
ATAATGCTTAATTTTAATCCGTTTTAATCCTTTTTATTAT
TTGTTCATGCACGTAAACTGGACATTTAAAGGGATAGCGC
ACCCAAAAGTGAAACTAAATTCACTATTTATTCTCCCTCA
TGTGTTTTCATGAGTTTCTTTCCTCTGTTGAATGCAAAGG
AAGATATTTAGAAAAAATGTGGAGAAAAGCAACCATTGGC
TATTATAATAGGACAAAAAAATGTTACTGTTGAAGTCAAT
GGGTGCATTTCTGAGGTAACATTTTAGGGTGAACTGTCCC
TTTAACAGGTATACATGCCTCTCTCCCATTGAGAAATCTG
AAAGGTGGAAAAATATGCAGATTACATGTATAATATGCAA
GAAAACGGGCCAATTTGACTCACTTTTGGGGCAATTATGG
TTCATTTTAGTCAGTGTTTATTTTTATTCATTCGCAAAGT
GTGTCATTTAAAGGGATATCGCACCCAAAATGAAACTAAA
TTCATCATTTATTCTCCCTCATGTGAGTGTCTTTTTTCTG
TTGAACACAAAAGAAGATATTTAGAAAAATGGTGGAGAAA
AGCAACCATTGACTTCTATAGTAGGACAAAAAGGTACCAT
GGGAGTCAATGGGTGCATTTTAGGTGAGATTTTTGGGGTG
AACTGTCCCTTTAACAGGTATACATTCATCTCTCCCATAG
AGAAATCTGATAGGTGGAAATATATGCACATTACATCTTT
GACATACAAGTACATGGGTCCTTTTGACTCACATTTGGGG
CAATTATGCTTCATTTTCTGTCAGTTTTTTATTATTTTTT
TATTAATATTCATTCACAGAGTGTGTCATTTAAAGAGATA
GCGCACCCAAAAATAAAACTAAATTCATCATTTATTCTCC
CTCATGTGAATGTCTTTCGTCTTTTGAATGCAAAGGAAGA
TATTTAGAAAAATGGGGGAGAAAAGCAGCCATTGACTTTT
ATAGTAACACATGGAAGTCAGTGGGTGCATTTGTAGGTGA
GATTTTTGGCGTGAACTGTCCCTCTAACAGGTATACATGC
ATCTCTCCCATAGTTAATTCTGATAGGTGGAAATATATGC
ACATTACATGTGTGATATGCAACACAAATGGCATTTTGTC
TCACTTTTGGGGCAATTGAGGTTCATTTTAGTCTGTTTTT
ATTTCATTTATTCGCAAAGTGTGTCATTTAAAGGGATAGC
ACACCCAAAGTGAAACTACATTCAACATTTATTCTCCCTC
ATGTGAGTCTCTTTCTTCTGTTGAACACAAAAGAAGATAT
TTAGAAAAATGGTGGAGAAAAGCAGCCACTGACATAAATA
GTAGGACAAAAATACTATTGAAGTCACTGAGTGCATTTTG
GAGTAAACGATGGAACATTTTTGCGTGAACTGTCCCTTTA
ACAGGTGTACATTCATCTCTTCCATATTGAAATATGATAC
GTGTTAATATATGCAAATTGATTATATCTCATATTCAAAT
TTTATATATTAATTTCATATATAAAACATGTATAGTCATA
TATGAACACACATTATGGCTAACATATACATGCATATTAT
TTATAATATATATTTACAATTCAAATGGTTTAAATGGTTT
ATATAAATAATAAAATTATTTTTAAAAAAGTCATTTTTGT
ATTATTTTAAAATATATGTTGCATATATACTTGTACGTCA
TATATGTAATTAGCATATATTACCATATATCAAGATTTCT
GTGTGTGTTATGTATTTTCTTTAGCTGTTTGTGGCATATG
ACTTGTAAAAATTAATTTAGGAAGTACAGTAATCGCATTA
TTATGTAGTTTCTGGATGCATGAATTGACGCTGTAACCTG
CTGTGTGAAGTGCGACTGAGAGTTTTGTTGTTTGTATATT
TTCTTGAACTTCTCTTCATATTAACATTGAGATTTTTGAC
GATGTAACTGTGCTTTATATTAATTGATGCATCATTCCAT
GTGCTGGACGTCATTGTTGTTGTTTAGACATGCAGATTTA
TTGCACATTTCCCTAAAGTTATCTCACTGTTGGAGCAGAA
TGTGTATATTTGAGTTTTTTGTCAGTAAATAAGGAGTTTT
AACCTTGAGGTGCTTAAAAACACTAAATAAATGACTGTCA
TCCTGACAGTACGCTTTTCTTAGACAAATAAATGTAAAAC
AATTTAATACCAATTTAAAGAAGTCTATTTTAGCTGTAAA
CTTTGTAGGTTTTTGAAGCTTTTTTCTAGAGTTTTCACTG
TTTTGTGGTTCTCTGTGATCTGAATTGTAAACCATTCTTT
AATAAAAGGGAGTTTTGCAATGAAA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
perp-201 Contained in:
OTHER perp-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000025874 (1)
  • Ensembl_Trans:ENSDART00000148356 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:DR730189 (1) 760bp
    GenBank:BC045901 (1) 729bp
    GenBank:BQ093467 (1) 575bp
    GenBank:BE556952 (1) 538bp
    CITATIONS (2)