Transcript

gsta.1-002

ID
ZDB-TSCRIPT-090929-8575
Name
gsta.1-002
Previous Names
None
Transcript Type
ncRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000025869 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000025869|OTTDARG00000020623|ZDB-GENE-040426-2720 gsta.1|no_translation gstal-002 LG_ AL929536.7 Danio rerio protein_coding KNOWN, 539 bp
CAAGAGTTCAAGACTCTCTTCATCCTCTCAAAATGTCCGG
GAAAGTCGTGCTGCATTACTTCAATGGCAGAGGGAAGATG
GAGTCGATCCGGTGGCTTCTGGCTGCTGCTGGAGTCCAGT
TTGAGGAGGTGTTTCTCACAGAAAAGGAGCAGTTTGACAA
ACTCCTGAGCGATGGAGCTCTGACGTTCCAGCAGGTTCCT
CTGGTGGAGATCGACGGGATGAAACTGGTACAGTCGAAGG
CCATCCTGAACTACATCGCAGGAAAATACAACCTCTATGG
AAAAGACCTTAAAGAGCGAGCCATGATCGACATTTACTCA
GAGGGTCTGATAGATCTGATGGAAATGATCATGGTGTCTC
CGTTCACACCTGCCGAAAACAAAGAGAAAGTCTTCAGTAA
CATTGAGGAAAAGGCCAAAGTGCGCTTCCTTCCAGTGTTC
GAGAAGGTACAGACAGCTCTGAGCATTACTTGGAGAGATT
ATTGACTCTCCATTAAGTGCTTATAAACATTTATGAGTTT
CTTTTATCTGTTGAACACA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations