Transcript

asb3-201

ID
ZDB-TSCRIPT-090929-8499
Name
asb3-201
Previous Names
  • asb3-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000025790 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000025790|OTTDARG00000020576|ZDB-GENE-030131-6142 asb3|OTTDARP00000021201 asb3-001 LG_ AL935052.8 Danio rerio protein_coding KNOWN, 1890 bp
AATCAGAAAACGGCGTCACCGGAAATGTCCGTTATATTTT
TCGGATACTGAAACTAATGTTACACCTTTTTTAATCATTC
AGTTGTTTACAGATGCTTTAGCACAGCAGTATAATATCTC
TTTATTGTATCGTGCATGTCTTATTAGTTTCGCAGCTGTT
AAGTCATTATTTTACAATCAAGGCAGGCTTATTTTACAAT
CATTTGCCAAGCTGATCATAGTTGGTGATGCACAGAATGT
TGTTCTAAAGTATGGACTTCACCGAGTGTTATGCAGACTC
TTGCTCAGCCGTTGCGCTGGCCGCCCGGGACGGGAAGAGT
CGCCGAGTTCAGAAGCTGATCCGGAGAGGCTTTGCTGTGG
ACGTGAAAGATAACCGGGGCTGGAACGCTCTGCATGAGGC
TGCGGCGGCTGGAACAGCGGGGTGTGTTCGGCTTCTGATC
CCCGCTGCTGTCAATTGCGAAGACTACGTCAACACTTTGA
CACACAACTCAGAGACTCCTCTATACTTTGCTGCGAAATA
TGGACACCTCCGGGCAGTGAAGTGGCTTATCAAAGCTGGT
GCAGACATTAACAGGAAGACCAATGATCTCTCCTGTCCCC
TCTATGCTGCTGTAGATGGTGGACATAAAGATGTGATTGA
GCTGTTGGTGAGAAATGGAGCAGAAGTCAATGGGACTTAC
TCTTTGTCAGGCTGGTCTTGCCTCCATCAAGCTGTTTACA
AGGGCCATATTGAGATTGTGCGGTACCTGGTGAGCTTGTG
CACTCTGGAGGCTGTGGATGACTATGGGATCACACCATTA
TTCGTTGCTGCACAATATGGACATCACCAATGCTTGGATA
TTCTTGCAAATGCTGGGGCAAATGTGAACTGCCAGGCAAA
CGATCTGGCCACACCTCTGCTCATTGCTGCTCAGGAGGGC
CACGAACAGTGTGTGGAGTGTTTACTGGCCCATGGAGCTG
ACCCGAACCTGTACTGCAATGAGTACTGCTGGCAGCTCCC
CATTCTCGCCGCGGCTCAGTTCAATCGATTGAGTATTTTA
GAGAAGCTGATTCCAGTAACAAAGCGAGAATGTGACCGGG
GTGAAGGAAAGGTCAGTCCGGTTTATTTGGCAGTACTTGG
TGGACACGCAGACAGCCTTCGGGCCTTGCTACAGAAAGGC
TACAGTCCAGATGCCCAGAGCTGTCCGCAGTTTGGCTACA
GCTGCCCTTTGGAGATGGCACTGTGGACATGGCTTGATGC
CTCTTGGAATTTAAACAGCGAGTGTCACCAAGCTCAAGAG
ATCACTCTGATTCTGCTGGCCGCAGGCGCTCATGTGAACA
CGTCCATCTACGGCTTCACTTTACAAGGCCATGTACCAGA
GCACCTGCCCTTAATCCTAAAGCATGCTGGTCTACCTCAG
GGTGACCGACTGCGAGAACTGATCGACAGAGCCCTAACTG
AGGTGAAAGATGCCTCTTTCTGGCTCCCCCTGCTGCTAAA
AGCGGGACTCGATCCCATGCTACTCCTCCAGGACAAACTG
CTTGAGGAAGCGGGGAACGACGCGCTTAATTTCTTTTTGG
AGTTTGTTAATTGGAAGACTCTGCCATCAGAAATGCTTCA
GATTCTCGCTCACCGGCGAGCCGAGGGCACCTGGACACCA
CGTAAACATTTCGAATCAGTCCCTGTCCTTGCGCATCTGT
GCCGCCTGGCAGTGCGGGCACACGTGGGCAGCGATACTCT
GTCTAAACCCTCCTTCATCCAGCAGCTGCCCATTCCCTCT
CTGCTTCAAGACTACCTTCATTTCAGCGACGTCTCAGGCC
TGCTTACGTAACTGTTCTCCATGGCTAATTAAGCTATCTC
CACCGCAGTATCTTGTACATAATGTTAATAAAATTTTAAT
GACCGCTCAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations