ZFIN ID: ZDB-TSCRIPT-090929-8479
Transcript Name: foxh1-001
Previous Name:

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000025763 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000025763|OTTDARG00000020557|ZDB-GENE-000616-15 foxh1|OTTDARP00000021182 foxh1-001 LG_ BX640453.23 Danio rerio protein_coding KNOWN, 3213 bp
AAGAGCTAGTGGCGCGCGTGAATATAATCAATTTTACAGG
AGAAAGGTCCACACATGTGGGACATATCGTGGAAAGGCCA
CTTAAACTGCCTTTCACAGTAAATCTGATCGCTGATGTAT
AGTGTCCTCCCCCGCGGTGATCGCGCATCGCGCCTCATTC
TCACTCCCATTACGCAGCGGGATTGACATGAAACTGTGAA
TTGTTTGCTGCTCAAATAGAGTTGACCTGGAGCCAGCAGT
CTGAGGGGTTGAGGAGCGACCATACCTTCCACCTCCCCCC
ACTACATCAGCATGACAAAGCACTGGGGGGGTCCAGGCTT
GTTGGCACCACCCGTGATCACCGTAGGAGAAGGAGCACAA
CGCGACCATCACCTTGACTGCAGAATCGGCTATTCCTCTT
CCAAGCGCAGCTGTCATCGCTCCTCAAACCCTTTGCTGGA
GCTCGGTGGCCGGCTGGATAAGTCCACAGGGATGGCGCAG
GACTCTTGTTATAGAGCCAAAGCGACGAATCAAGGCCCAT
GGGAACTGCAGGATGGAAACTCCAGTGGAGGAAAGAAGAA
AAACTATCAGCGTTATCCCAAACCACCGTACTCTTACCTG
GCAATGATCGCAATGGTCATCCAGAACTCGCCAGAGAAGA
AGCTTACTTTATCAGAGATTCTGAAGGAGATCAGCACTCT
CTTTCCATTCTTTAAGGGGAATTACAAAGGCTGGAGGGAC
TCTGTCCGACACAACCTGTCTTCATATGACTGCTTTGTCA
AGGTGCTTAAAGATCCTGGAAAACCTCAAGGTAAAGGTAA
CTTTTGGACTGTGGAAGTGAACCGAATTCCCTTGGAGCTG
CTAAAGAGACAAAATACAGCAGTGTCCCGTCAGGATGAAA
CCATCTTTGCTCAGGACCTGGCTCCGTACATCTTTCAAGG
TTACAGTCAGCCGAACAAGTCCAAACCTCTTCCCCCTGAA
TCATCTTTACCCCCTGTTCCAACCCGTCACAGCCCACCTC
CATCAGAGGACCCATATCGTCCCAAATTGGACTCTACGTT
TGCTATAGATTCTCTCCTGCATAGCCTCAGGCCTGCCAGT
TCAGCTGGGGAGGGGTTACGGGAGAGAGAAAGTTGGGGCG
TCGGACCTCCTCCACACACTCGCTCTACCACTCCCCCACG
CCCTTGTAATGCTTCATACAATGGCAGTTCATCAGCCAGC
TCTGTCAGTCCCGCATCCGATTTTTCTGATGAGGACTGGA
GAGGGGTGACAGTTGTTGGGAAAAGATCAGGAGACAGAGG
AATAACATCAGATGCATACAGTGACTCCTGTCCTCCACCA
AACAAAAGTTCCAAACGAGGCAACACCCCGCCATGGGAGC
TACCTACTTCCTATGCCAAGTACACCCCTCCCAATGCTGT
AGCCCCTCCAAGCATGCGCTTTAATGGAAATCCATTCATG
CCACTAGGTGGTATTCCATTCTATGGTTATGGTAGTGCAC
ACGTTACTACATCACATCTGATAGGTCACCCATACTGGCC
CATTCTGCCAAGTGGGCCAGTATCCATACAAGCACCTCCC
CTTCTCATGGACTTGGACAGTATGCTGCAATCAGTTCCGC
CCAATAAGAGCGTGTTTGATGCGCTTGGATCCAACAATCA
GACTGTTCATCCGTCTCCAAACCAGTATGCCCTACAGAAC
GGACCTTCCCTTTGCAAATATTCTCTTTAAACTGTCCACA
TCCATCTCAGAATAGTCTTGGAGGAAAAGGTTTTCCTATT
TTGGGCACTGCTGACATTCTCTGGGGGAAATGTACAACAG
CTGGCTGCAGGAGCAGTCTTTTCAAAGGGATATTTTGCCT
TATTTACGCACAAAAATTTATACTAGTACTTTAAAGGGTA
CATGCTACTACTCTACTGGTAAAAAGGTAACTTTTTTTGT
GGTAGATAGGGTATAAAGATAATATTTTCAGTGCTGCACT
GCCCTGGCAACAAGCTGTTGTACAGTTTATGCACATGTTT
GGCATGGCAGTGCAAGTTTATACAAAGATTTGCAATAACT
AATGCTGCTCATCACAGGATAGACCAACTGTGGCTTGTCT
CAGGGAAATTCTTTATGAACAGAACTGAAAATACAGTTAA
AACAGGCCAATATTGACCAAACATTTAATTGACTCCATTG
TAACTCATGTGACTTTCTTTAACACAGTTACTACCTCAGA
ATTTTACAATCTTTGAAGAGGAGCATTTGCTGCTCTTGTT
TTCTAATATTGGCCCTTGTAATGTTTTGTGATAATGCAAT
GAAACACTTGACTTGAGCAGTGGAATGTTGTCTGTTTATG
AGTTGTTTTACTTCGTAAATGGACAGTTGCAGGAATAAGC
AATGTGTTCGTGTGTGAATGTGTAGAAACTGTGAGGAACC
TGCAATGTTTACATAAAGACAGGCCTTTATGCCATGAATG
TGTCACTGTTTATACATTAGCTTTTACCATGTTTTTTGTG
TATGTGTATATTTTTTAGACATGATTCCCACAGCCAGTTC
TTAGTTGTTTTTAAAACACTTTCATTACACCCCCATTCCA
ATTGGTAAAGTCCAATCTCAGGTTCTGATAACAGTGGTGG
GGGCTTGACAGATCTGATGAGATCCAGTCTTGTGTGTGTG
TTTTGTTATTACTGGCAAACATTCACTTTGAAGAACTGTA
ATTGGAGCCATTTTTATCAGTGTACTGTGTCAAATCCTTA
TCACTACTCATTGTGTTCCTGTGGAATGTAGGTGGTGTAA
CTACGATTTTTAGAATCTGCCTTTTTTAATATGACTGCTT
ATTTCACCCTTTTAAAAATGTCAATTTGTATAAAATGATC
TAAAAGCTCATATTGAGCAATTTGGTCATTGATTGAATGT
AAGCATCGTTTAATTGGTGGTCTGTGGTTGTCTCTGTCTG
TCTGGTGCACGTCATCCCATCACCTCCTGCTGCTATTTTC
TGTCCTGTCCTTTTTTTAAAATCATTCATCCACACCCCCA
ACACTTCCACCCTCTAGCAGGTCTATTCTTTGCAATGGGC
TTTAATTTGAGTGTAGAGGGGATCCTCAGTTTGTGAGAGA
TTAACTTCCACTAAGTTTGAGTCTTTCTTTGTTGTATTAT
TATGTCATGAGAATGCAGTCAAACTGTATTGGTCGATTTG
TTTTCAGTATGTTCATTTTAACCATATTTGTATAAAGCTA
CCTAATTCCTTAA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
foxh1-001 Contained in:
[BAC] DKEY-9L5 (1) (order this)
OTHER foxh1-001 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000025763 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:AF263000 (1) 3192bp
    GenBank:BC044340 (1) 2682bp
    GenBank:AF264751 (1) 2177bp
    CITATIONS (1)