Transcript

peli2-201

ID
ZDB-TSCRIPT-090929-8448
Name
peli2-201
Previous Names
  • peli2-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000025731 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000025731|OTTDARG00000020533|ZDB-GENE-040718-360 peli2|OTTDARP00000021154 peli2-001 LG_ BX511267.6 Danio rerio protein_coding KNOWN, 2448 bp
GAAATGTCTCCCAGACTCTAGGCTTTATTTTTATATTTTC
TGTCGGATATGTTATTTTGCTGATTTGAATTATTTTTAGA
AAAGTACAACGTAAGACTGGGCGCAGGTAAAACGGGTAAC
ATGGCTGTTAAAAGCGTCCTTTGAAGTCTTTCCCTTTTCG
TCGCTGGATTGATCGTGTAATTGAGAGAGAGAGGCGCCGT
GTTGTCCGAAAAGCCTCATGTTTTCACCGGGTCAAGAGGA
GCACTGTGCGCCCACCAAAGAGCCAGTAAAGTACGGGGAA
CTGGTGGTTTTAGGGTACAATGGCTCCCTCCCCAATGGTG
ACAGAGGGCGAAGGAAAAGCCGGTTTGCCCTTTACAAGAG
AGCCAAAGCCAATGGGGTCAAGCCCAGCACTGTACACATC
CTTAACACACCACAAGCCAGCAAGGCAGTGAACTGTAAGG
GCCAGCACAGCATCTCCTACACGCTGTCCAGAAACCAGAC
GGTGGTGGTGGAGTACAGCCATGACAAAGACACGGACATG
TTCCAGATCGGCCGATCGACGGAGGGCCCGATTGACTTTG
TGGTGACTGACACTGTGTCAGGGGGAGGAGAGAGTGAGGA
GACACCCATCACTCAAAGCACCATCTCCCGCTTCGCCTGC
CGGGTGGTGTGTGAGCGTAACCCACCCTACACCGCACGAA
TCTTCGCTGCAGGCTTCGATTCTTCCAAGAATATATTTCT
CGGAGAAAAAGCAGCCAAATGGAAGAATCCAGATGGTCAC
ATGGACGGTTTGACTACCAATGGGGTGCTAGTCATGCACC
CGCGGGGCGGGTTCACAGAGGAATCCAAGCCTGGTGTGTG
GAGGGAGATATCAGTGTGTGGAGATGTTTACACACTGAGA
GAAACACGCTCTGCTCAAACTCGAGGAAAATTGGTGGAGA
GTGAAAGTAACGTTCTGCAGGACGGCTCTCTGGTTGACCT
TTGTGGAGCAACGCTGCTCTGGCGCACCGCTGACGGCCTT
TTCCACACCCCCACACAGAAGCACCTGGAGGCCTTGCGGC
AGGAGCTGAACGCAGCCCGGCCCCAGTGCCCTGTGGGCCT
CAACACACTGGCCTTTCCCAGCATGCAACGCTGCAGTCGT
GCCCTGAGCAACGTCCCTGCCCAGGAAGACAAACAGCCCT
GGGTCTACCTTGCCTGTGGTCATGTTCATGGCTACCACGA
CTGGGGCCACCGATCAGAGCGGGAGTCCAATGCCCAAAGA
GAGTGCCCCATGTGCAGGGCCGTGGGTCCCTATGTGCCAC
TCTGGCTCGGATGTGAACCAGCCTTCTACGTAGACACTGG
TGCGCCAACACACGTCTTCGTACCTTGTGGCCATGTGTGC
TCTGAAAAGTCCACCCGCTATTGGGCAGAGATTCCTTTGC
CACATGGCACCCACGCTTTCCACGCTGCCTGTCCTTTCTG
TGCTACTCAACTCAACCTGACACAAAAGTGGGCCAAGCTC
ATCTTTCAGGGGCCTATAGACTGAGAGCGTAGAGGAGGTC
ATGGGGAACTGGTGGATTGTTGTCTAATTGAAGGGGAAAC
CAGTATGCTGAAGGACTATTAGTAGGTGTCATTTTTAAGG
AGCGACTCAAACCACAAGCTGTGAAGCTGCCCTTGATCTG
CTGATGATGGAGAGCAGGTTTCTGTTCAGACAACCGTTGC
CTTGGCGTATGACAGGAGGCGTAATTCCATCATCATTTCC
TGACCTTTTTGTCTACAGGCCTTCAAGATGTCAGATCACA
CCAGCATTACCACATCACTCAGGATGTTTAATACAGTTCT
CCAGGACACTCCGCTTTAGACCTGAGGTGCTGCATCTGGT
TCCTGGTGATTGACTTTCCTGCAAAGTTTTGTTGCTTTAA
TAATTCTTCCGGTGATTTCCAAAGAACTCCATTATCTGAG
CCTAGTGTGTCGGGTTGGAGCCCAAGTTGGAGTCCAAGGA
GCAGCAGTGAACATTCATTATTCGTTAAGTAGTTCAGTGT
GTGGGGATATTCCCAAAGGTCTGGATCCAATATCCCAAAC
TCTACTGAGTGCTTCTACAGGAATGGTTGGAGCAGATATT
TGGGATCTGCAATACTAAAATGGTTTTCCAAAGATAAAAA
GGGCGATTTTAAGTTTTTATGTTATCCTTTATACGAAGAG
CTAGCAAGATTAACACTCCTTAATGATTCCACAGGAATGC
TGATCAGACACAGTGGAAGCTTCATTTTGAAAATGAATTA
GAGGAATTTTTGACATTTTTAGCCTAGTCCTCCTAGTGTT
CACCTACTTCAGAGATGTCAAGTGTTTGGAAACTTACGTG
TCTTTACATAAAATCTTTAAAGGTATTTTTATTCATACCG
GGATAACCGGTAATAAGATTAACAAAGAATGCAGCCAAAT
ATTTTTGGAAATGGCTGTAGAGTTGATAAATAAATGAAGT
ATTCCTGG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations