header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-8428
Transcript Name: dpysl5a-202
Previous Name: dpysl5a-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000025711 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000025711|OTTDARG00000020521|ZDB-GENE-030131-3136 dpysl5a|OTTDARP00000021135 dpysl5a-001 LG_ BX571720.6 Danio rerio protein_coding KNOWN, 3509 bp
ACGCCCGGCTCTCACAGTCTGGATGCTGCTGCAAGCGTGA
GGTTTACCGGGCTGGACCAACCGAAGCATCTGCCTGCCGG
TCTAACAGGCTTTTATTGTTCAAGAGCGCTCAAAGTGAAG
GAAAACCTCTTTTAAAGGATATCACAAAGGAAGTTGAACC
ATGTCTTCCAGCTCAGCAACGGTGCGCATCCTCATAAAGG
GAGGTAAAGTGGTGAACGATGACTTCACACAAGAAGCGGA
TGTGTACATCGAGAATGGCATCATCCAGCAGGTGGGCAAG
GAGCTGATGATCCCAGGTGGGGCCAAGGTTATAGATGCCA
CAGGAAAGCTGGTGCTTCCGGGTGGCATAGACACCAGTGT
TCACCTAAACGAGAGCTTCATGAACGGCACTACAGCAGAC
GACTTCTACAGCGGCACAAAGGCGGCTCTGGCTGGAGGCA
CTACTATGGTGATTGGTCATGTGCTACCAGAGAAGAACGA
GTCATTGCTGGATGCCTATGAAAAAGCCCGCTCTCACGCT
GATGCCAAAGCCTGCTGTGATTATGCCCTGCATATGGGAG
TGACCTGGTGGGGACCTAAGGCTAGGGCTCAAATGGAGAC
ACTGGTGCGGGACAAAGGGGTGAACTCCTTCCAGATGTAC
ATGGCGTATAAGGACATGTACATGCTGAGGGACAGCGAGC
TGTTTCAGGCCCTGCAGAACTGTAAGGATATTGGTGCTGT
GGCCCGTGTCCACGCGGAGAACGGAGAGCTGGTTGCTGAG
TCGTCATTATCTCATGTTTTCATTTTTACACACAAGGGTG
CCCGAGAGGCCTTGGATCTGGGTATTAGTGGACCAGAGGG
CATTGAAATAAGCAGACCTGAGGAGCTGGAAGCAGAGGCC
GTCCATCGAGCCATCACCATCGCTAACAGAGCCCACTGTC
CCATATATCTTGTGAATGTTTCCAGCATGTCAGCAGGAGA
CGTTTTAGCCTCAGCTAAAATGCAAGGGAAAGTGGTGCAT
GGAGAGACCACCACTGCTCACGCTGTCTTAAACGGGATGC
AGTATTATCACCAGGACTGGGCCCACGCAGCTGCTTTTGT
CACTGTGCCGCCACTCAGACTCGACCCCAACACACCCAAT
TACCTGCTCAGCCTTCTGGGAAATGATACTCTGAACGTTG
TGACATCGGACCACCGACCCTTCACCACTAAACAGAAGGC
GATGGGCAAAGATGACTTCACCAAAATCCCTCACGGCGTT
CCTGGAGTTCAGGACCGTATGAGCGTCATGTGGGAACGAG
GAGTGGTTGGAGGCAAGATGGATGAGAATCGTTTTGTTGC
TGTCACCAGCTCCAATGCTGCAAAGATCTACAACCTTTAC
CCCAGAAAGGGCAGGATCATCCCTGGAGCTGATGCTGACG
TGGTGGTTTGGGATCCAGAATCAACAAGGACCATCTCAGT
GACCACTCAGTGGCAGGGTGGTGATGTGAACCTCTATGAG
AACCTGCGCTGTCACGGCGTCCCCCTGGTCACTATCAGCC
GCGGTCGCGTGGTCTATGAAAACGGCATCTTCACTTGTGC
TGAGGGCTCCGGAAAATTCTACCCTCTCCGAACCTTCCCA
GACTATCTCTACAAGAAAATGGTCCAGAGGGAGAAGTGTC
AAGCACTCAAGGGGGTGGAGCGCACACCCTATACTGGAGA
TGTGGCTGCGGTGCAGAATTCCGGGAAGAAGGATCTCGGC
CCTGCAGACGGGGACATGAACCCACGACCCTGCACACGCC
ACGGAGGAGTGAGAGACCTCCACGAGTCCAGCTTTAGTTT
GTCTGGTGCCCAAATTGATGATAACGTTCCAAAGAGAGCT
TCTGCAAGGATTCTGGCGCCCCCTGGTGGTCGTTCAAGTG
GAATCTGGTAACTGGATCAACACTTACAAAGAAAAAGTCT
GAAATTACACACTTACGGTGCATTCTGACAACCTCACATC
TGGTGAAAATTATTTAATTTAACCACTCGCAACTAAACTT
CCAGTGTTGGTTTTTTTATATATATATACATGTGTAAGAG
GTGAAAAAAAAAACATTTGTGCAGAAATTGGAAAACAAGG
TAAAGTCAGAGAGATTTGGTAATACAAAATGCTACAGGGT
GTTTTATTCTGAAATACTTAGGGTTATGTTCAAAAGTTCA
AACACAAAACCGTTTTAGTGCTAAATTAACCGCAGATATT
GGTTTTGTTCCACACTAACACATTTACAACATTTCTGCTG
CCGTTTAAAGAAATGGGGATGTTTAGTTTGTGTAGTTGGT
CATGGCTTAAAAAAATGTGAACCATTGTAAAGTTATTTAA
TCTTTTAACTGTTTTAATGTGTTGGCAGATGACTATACAT
TTACCTCAGTGTTTTTCTCTCGTGTGTACACTCACACCCG
GCCTCTATTACAACACTTACAGACAACACTTTCTGACAGC
AGACATCAAAAGATAGTTTTACTTTCGTTAAGATGTTAAT
ATTCTTCATTTCTATTTTTAATTCATTTTTAATATGCTGA
TGATTCAAAGCAAATACAAGGAGATATCCATGGTTTTGGT
CTGTGACCACTTTAGTATTCCCTTTGAAAGAAAATCATTT
ATATGAAGCATTTGTTGTTTATAAGCACACAAACCTGACC
TAAAATTTGAATTAAAGAGATAGTTTGCCTAAAAATAATA
TTCTGTCATTATTTATTGACCCTCAAGCGTTATGAATATG
TGTTATTTGTGATGTTTTGAAGAATGTTTGTTAAAATGCA
GCCATTAAAATTAATTGTAGGACAGAAAACTGGATCAGTG
TACAGATTTCCATCATTCCTCAAAATATCTTCCTTTTTGA
TCCACACAAGAAAGATGGTGGATGTCAATGTCTACAGGTT
TCCAACATTCCTCAGAATCTTTTTTTTTAATCCACACAAG
AAAGACAGTGAGTAAATGATGACAGAATTGTAATTTTGTG
TAAACTGTCCTTAATATATCAAATTTTGTTGATCTGAACT
TTGGCTTCCTTTTAAATCTCATAATTGAATTATTCTTCAT
AACATTAGCATAATTTTGCTGTTTGTTCTAGATTTACCTA
TATAGTGTCATTCCATTGGTTGCTCGATGAACATTATTGC
AACTATTAATCTGCATGTTTCCAATTAACTCACTTCTGAT
CAATGAGCTCCACAAACTCCAGGTAAAAAGACAGCAGACA
GTTTACCGGCGAGGCATGTGTTCTCTTTGTACATGTGTGT
CTAACTGAGCACTTGAAAACCTTCTGTAGAGACCATTTAA
AACACCGTAACTTTAGCTTGTACAACTCGATGTTCCTGTG
ACACAAGCGGTAGAATGGCGAGAACGTTTCAGTTGGTGCT
GAATTTCCATGTATTTTTTTATTCTGTATTTTCAGTATGC
TTTTTTCGATTTTTTAATATGAGCTGTGTACGCACTACAG
TTGTACGTATTAACGTATTGTTTATCTCATGAAAAAAAGA
AAAGTGCAAATAAACTCCCTTCAACCTCA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
dpysl5a-202 Contained in:

OTHER dpysl5a-202 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000025711 (1)
  • Ensembl_Trans:ENSDART00000145236 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:AY987371 (1) 3488bp
    GenBank:CK140019 (1) 865bp
    CITATIONS (2)